ID: 1126063220

View in Genome Browser
Species Human (GRCh38)
Location 15:44804096-44804118
Sequence GGGACCTAGCCTATGTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126063213_1126063220 9 Left 1126063213 15:44804064-44804086 CCTCAGTGACCCTGTCCTCCAGA No data
Right 1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG No data
1126063218_1126063220 -6 Left 1126063218 15:44804079-44804101 CCTCCAGATGTGCTACAGGGACC No data
Right 1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG No data
1126063214_1126063220 0 Left 1126063214 15:44804073-44804095 CCCTGTCCTCCAGATGTGCTACA No data
Right 1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG No data
1126063215_1126063220 -1 Left 1126063215 15:44804074-44804096 CCTGTCCTCCAGATGTGCTACAG No data
Right 1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG No data
1126063212_1126063220 14 Left 1126063212 15:44804059-44804081 CCAGGCCTCAGTGACCCTGTCCT No data
Right 1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG No data
1126063219_1126063220 -9 Left 1126063219 15:44804082-44804104 CCAGATGTGCTACAGGGACCTAG No data
Right 1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126063220 Original CRISPR GGGACCTAGCCTATGTGCAA AGG Intergenic
No off target data available for this crispr