ID: 1126072301

View in Genome Browser
Species Human (GRCh38)
Location 15:44875691-44875713
Sequence GCTCCTAACTCCAAAGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126072296_1126072301 21 Left 1126072296 15:44875647-44875669 CCGGAAGTACAGGAGAAGCAGAA No data
Right 1126072301 15:44875691-44875713 GCTCCTAACTCCAAAGAGTTGGG No data
1126072295_1126072301 22 Left 1126072295 15:44875646-44875668 CCCGGAAGTACAGGAGAAGCAGA No data
Right 1126072301 15:44875691-44875713 GCTCCTAACTCCAAAGAGTTGGG No data
1126072298_1126072301 -9 Left 1126072298 15:44875677-44875699 CCAGGCAAACCAATGCTCCTAAC No data
Right 1126072301 15:44875691-44875713 GCTCCTAACTCCAAAGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126072301 Original CRISPR GCTCCTAACTCCAAAGAGTT GGG Intergenic
No off target data available for this crispr