ID: 1126076245

View in Genome Browser
Species Human (GRCh38)
Location 15:44913128-44913150
Sequence ACCCAAGACATACACAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126076245_1126076247 17 Left 1126076245 15:44913128-44913150 CCTTATCTGTGTATGTCTTGGGT No data
Right 1126076247 15:44913168-44913190 TCTCTTGTTTGTGTAACTGTGGG No data
1126076245_1126076248 28 Left 1126076245 15:44913128-44913150 CCTTATCTGTGTATGTCTTGGGT No data
Right 1126076248 15:44913179-44913201 TGTAACTGTGGGTCTGTTTTAGG No data
1126076245_1126076246 16 Left 1126076245 15:44913128-44913150 CCTTATCTGTGTATGTCTTGGGT No data
Right 1126076246 15:44913167-44913189 TTCTCTTGTTTGTGTAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126076245 Original CRISPR ACCCAAGACATACACAGATA AGG (reversed) Intergenic
No off target data available for this crispr