ID: 1126083344

View in Genome Browser
Species Human (GRCh38)
Location 15:44987087-44987109
Sequence GTGGTGAAGCCTAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126083344_1126083349 26 Left 1126083344 15:44987087-44987109 CCATCCTCACTAGGCTTCACCAC No data
Right 1126083349 15:44987136-44987158 TTCCTGACCCACTTTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126083344 Original CRISPR GTGGTGAAGCCTAGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr