ID: 1126085477

View in Genome Browser
Species Human (GRCh38)
Location 15:45007295-45007317
Sequence TGGAACTCTTAGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126085470_1126085477 13 Left 1126085470 15:45007259-45007281 CCCACATGAGAGAACCTAAGATA No data
Right 1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG No data
1126085471_1126085477 12 Left 1126085471 15:45007260-45007282 CCACATGAGAGAACCTAAGATAA No data
Right 1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG No data
1126085472_1126085477 -1 Left 1126085472 15:45007273-45007295 CCTAAGATAAATTCTAACAGCCT No data
Right 1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126085477 Original CRISPR TGGAACTCTTAGGGAAAAAC AGG Intergenic
No off target data available for this crispr