ID: 1126089261

View in Genome Browser
Species Human (GRCh38)
Location 15:45036928-45036950
Sequence ATGTTTCCTTGCCATGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126089261 Original CRISPR ATGTTTCCTTGCCATGATGT TGG (reversed) Intronic
900363806 1:2302369-2302391 ATGTTTCCTTCCCATGGGGAGGG + Intronic
909865296 1:80661157-80661179 ATGACTCTCTGCCATGATGTGGG + Intergenic
912730435 1:112097725-112097747 AAGTATCCTTGCCAGGATATAGG - Intergenic
913497574 1:119442446-119442468 ATTTTTCTTTGACATGATGCTGG + Intergenic
915239497 1:154509967-154509989 ACGTTCCCTTACCATGGTGTGGG - Intronic
917374656 1:174336785-174336807 ATGTTTCCATGCAATAATCTTGG + Intronic
921678883 1:218008270-218008292 ATTTCTCCTTACCATTATGTTGG + Intergenic
922175897 1:223197373-223197395 ATGTTTGCTTTCCGTGGTGTGGG + Intergenic
922590285 1:226770257-226770279 TTGTCTCCTTGCCCTGATTTTGG - Intergenic
923956270 1:239025282-239025304 AGGTTTGTTTGCCTTGATGTTGG + Intergenic
924126605 1:240860474-240860496 AATTTTCCTTGCTCTGATGTTGG + Intronic
924314746 1:242784284-242784306 CTGTTTCCTGGCCAGGATGCTGG + Intergenic
924876623 1:248111819-248111841 ATGGTTCCTTGCCTTCATGGAGG + Intergenic
1064605373 10:17033415-17033437 AGTTTTCCTTGTCATGATGGAGG - Intronic
1064702985 10:18040918-18040940 ATTTTTGCTTGCCATGATTGTGG + Intronic
1064985825 10:21208824-21208846 CTTTTTCCCTGCCATGCTGTTGG - Intergenic
1072462321 10:95631012-95631034 ATGTTAACCTGCCTTGATGTGGG + Intronic
1073950503 10:108803736-108803758 GTTTTTCCTGGCCTTGATGTTGG + Intergenic
1075662031 10:124204426-124204448 AAGTCTGGTTGCCATGATGTAGG - Intergenic
1077625593 11:3768569-3768591 CTGTTTCCTTACCATGGTGTTGG + Exonic
1080815042 11:35747519-35747541 CTTTTTCCTGGCCATGAGGTTGG - Intronic
1088423849 11:109678808-109678830 ATGATCCCTTGCCAAGTTGTTGG - Intergenic
1092646279 12:10576787-10576809 ATATTTTTCTGCCATGATGTTGG - Intergenic
1099530430 12:83772749-83772771 TTGTTGCCTTGCCATTATTTAGG - Intergenic
1102551933 12:113697679-113697701 CTGTTCCCTTGCCTTGAAGTGGG + Intergenic
1102636704 12:114330971-114330993 TTGTTTCCTTGCCCTGATCAAGG - Intergenic
1106542182 13:30699902-30699924 TTGTTTCCATGTCATGATGAAGG + Intergenic
1108106860 13:47020025-47020047 ATGTTTTCCTGCCATTTTGTAGG - Intergenic
1108337517 13:49461201-49461223 ATATTTTCTTGCCATGAAGCAGG + Intronic
1109051234 13:57483808-57483830 ATATTTTGTTGCCCTGATGTTGG - Intergenic
1111331328 13:86763947-86763969 ATATTTCCTTCCCAGGAGGTGGG + Intergenic
1112706364 13:102073585-102073607 AAATTTCCTTGCAATGAAGTTGG - Intronic
1113188582 13:107718036-107718058 CTGGTTCCTTGCCAGAATGTAGG - Intronic
1115149658 14:30269997-30270019 ATGTTTGGCTGCCATGTTGTAGG - Intergenic
1115760429 14:36575514-36575536 ATTTTTCCAAGCCATGCTGTGGG - Intergenic
1116168353 14:41363821-41363843 ATGTTTCCATTACATGATTTGGG + Intergenic
1116860516 14:49991979-49992001 ATACTTCCTAGCCATGCTGTTGG - Intronic
1117029756 14:51656013-51656035 ATGTCTACTTCCCATGCTGTGGG + Intronic
1118632153 14:67715410-67715432 ATCTGTCCTTGTCCTGATGTTGG + Intronic
1118876901 14:69793638-69793660 AGGTCTCCCAGCCATGATGTAGG - Intronic
1202845793 14_GL000009v2_random:173657-173679 ATGTTTTCTAGGAATGATGTTGG + Intergenic
1202915191 14_GL000194v1_random:163925-163947 ATGTTTTCTAGGAATGATGTTGG + Intergenic
1126069547 15:44853832-44853854 ATGTTTCCTTGCCATGATGTTGG + Intergenic
1126089261 15:45036928-45036950 ATGTTTCCTTGCCATGATGTTGG - Intronic
1127282667 15:57505085-57505107 TTGTTTCCCAGCCATGCTGTTGG - Intronic
1127402140 15:58599282-58599304 ATATTCCCTTGCCATGATTATGG - Intronic
1130804079 15:87300425-87300447 ATTCTTCCTAGCCATAATGTGGG + Intergenic
1131708627 15:95026979-95027001 CTGTTTTCTTGCCTTGATTTTGG + Intergenic
1131956607 15:97742709-97742731 CTGGTTCCTTCCCATCATGTAGG - Intergenic
1132456123 16:24080-24102 ATTTTTCCATGCCGTGATTTTGG - Intergenic
1133174912 16:4006924-4006946 ATGATTACTTGAAATGATGTTGG - Intronic
1133505352 16:6406722-6406744 ATGCATGCTTGCCATGATGGGGG - Intronic
1134124593 16:11607873-11607895 ATCTTTGGATGCCATGATGTGGG - Intronic
1134510937 16:14846409-14846431 ATGTTTCCTGGGGATGAGGTAGG - Intronic
1134698580 16:16244900-16244922 ATGTTTCCTGGGGATGAGGTAGG - Intronic
1134973255 16:18549773-18549795 ATGTTTCCTGGGGATGAGGTAGG + Intronic
1135883860 16:26286129-26286151 ATTTTTCCTTGCCTTGGTTTAGG - Intergenic
1139462230 16:67131810-67131832 ATGCTGCCTTGCCATAATGGGGG - Intronic
1143841433 17:9735225-9735247 ATGGTTAATTGCCATGATCTGGG + Intergenic
1146284218 17:31563777-31563799 ATGTTTAGATGCCACGATGTAGG + Intergenic
1150040922 17:61860347-61860369 ATGTTTCCTTGTGTTCATGTGGG - Intronic
1150915072 17:69428589-69428611 ATGTTTGCCTGCCATGTTATGGG - Intronic
1154004274 18:10513436-10513458 ATGTTTCCTTGGCATGTTACAGG - Intergenic
1154076130 18:11203587-11203609 ATGTTTCCCTGCCTGGGTGTAGG - Intergenic
1157130726 18:45004922-45004944 ATGTTCCCTGACCATGATGATGG - Intronic
1158032977 18:52989536-52989558 TTGTTTCCTTGCTGTGATTTTGG + Intronic
1158481550 18:57825781-57825803 ATGTTTTCATGCCCTGATGAGGG - Intergenic
1160892158 19:1384720-1384742 ATGTTTCCTAGCTATGGTGCAGG - Intronic
1165897495 19:39151643-39151665 ATCTTTCCCTGCCTTGATCTTGG - Intronic
1167833446 19:52046725-52046747 ATCTTACTTTGCCATGATGTTGG + Intronic
1168426900 19:56246155-56246177 ATGTTTATTTGGGATGATGTGGG + Intronic
1202673198 1_KI270710v1_random:14149-14171 ATGTTTTCTAGGAATGATGTTGG + Intergenic
925800018 2:7589865-7589887 ATATTTACTGGCCTTGATGTTGG - Intergenic
931786900 2:65628003-65628025 ATGTTTCCTCGCCCTGATTCTGG + Intergenic
932903774 2:75728584-75728606 ATGCTTCGATGCCATGAGGTAGG + Intergenic
938701762 2:133885888-133885910 ATCTTTCCTTGTCATCTTGTGGG - Intergenic
938749541 2:134315367-134315389 ATGCTTACTTGGCATGATGGGGG - Intronic
939396216 2:141632922-141632944 TTTTTTCCATGCCATAATGTAGG + Intronic
940136792 2:150446171-150446193 ATGTTTTCTTGCTATTTTGTTGG + Intergenic
940220982 2:151351228-151351250 ACTTTTCCTTTCCATCATGTAGG - Intergenic
940804508 2:158171111-158171133 ATTTTTTATTTCCATGATGTTGG + Exonic
942187882 2:173441641-173441663 TTATTTCCCTGCCATGAAGTAGG + Intergenic
942332723 2:174844528-174844550 ATGTATCCTTGTCATTATGGTGG - Intronic
944388852 2:199196121-199196143 CTGTTTCCTTGGCATGGTGAAGG + Intergenic
945319355 2:208404010-208404032 ATGTCTCCTTCCCATGATTATGG - Intronic
946610915 2:221456772-221456794 ATTTTATCTTGCCATGATGTAGG - Exonic
946854520 2:223939814-223939836 ATTTTTGGTTGTCATGATGTGGG - Intronic
1171504142 20:25619735-25619757 ATGTGTCCTTGCACTGCTGTAGG - Intronic
1172651858 20:36508767-36508789 ATGTCTCTCTGCCATGAGGTGGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176634544 21:9178571-9178593 ATGTTTTCTAGGAATGATGTTGG + Intergenic
1176638770 21:9276224-9276246 ATGTTTTCTAGGAATGATGTTGG - Intergenic
1177501392 21:21960641-21960663 ATTTTTCTTTCACATGATGTTGG + Intergenic
1178687777 21:34724700-34724722 ATGATTCCTTCTCATGATCTTGG + Intergenic
1180370287 22:12028202-12028224 ATGTTTTCTAGGAATGATGTTGG + Intergenic
1180372073 22:12049068-12049090 ATGTTTTCTAGGAATGATGTTGG - Intergenic
1180415531 22:12707887-12707909 ATGTTTTCTAGGAATGATGTTGG - Intergenic
1180422812 22:12883731-12883753 ATGTTTTCTAGGAATGATGTTGG - Intergenic
1181426396 22:22843994-22844016 TTGTTTCTTTCCCATGAGGTTGG - Intronic
1182476122 22:30577268-30577290 ATGTTTTCTCACCATGAAGTGGG - Intronic
1183230262 22:36577791-36577813 ATGTTTCCTAACCATGGGGTGGG + Intronic
1183680274 22:39324482-39324504 CTGTTTCATAGCTATGATGTAGG - Intergenic
1184332629 22:43835724-43835746 ATGCTTCCTTGGAATGAAGTGGG - Intronic
951904673 3:27692880-27692902 GTGTGTCCTTGCCATGTTGCAGG - Intergenic
952635947 3:35531345-35531367 AAGTTTCCTTGCTGTGAAGTTGG - Intergenic
952720121 3:36523873-36523895 ATCTTCTCTTGCCATGGTGTTGG - Intronic
953095594 3:39771811-39771833 ATGATTACTTGCTATGATTTTGG + Intergenic
954235753 3:49255946-49255968 AAGGTTCCTTGACATGATGTGGG + Intronic
955936397 3:64106909-64106931 GTGTCTCCTTGCCATCAGGTGGG - Intronic
956069599 3:65433773-65433795 ATGTTTCCCTGCCAGGATGGGGG + Intronic
956871325 3:73421010-73421032 ATGTTGAATTCCCATGATGTAGG - Intronic
957102090 3:75840893-75840915 ATGTTTTCTAGGAATGATGTTGG + Intergenic
958669057 3:97179960-97179982 CTGTTTCCTTGCCTTAAGGTTGG + Intronic
959644819 3:108686698-108686720 ATGTTTCCTTACCTTGACCTTGG + Intronic
960137182 3:114117762-114117784 AATTATCCTTTCCATGATGTTGG - Intergenic
960875256 3:122289367-122289389 ATGTTTTTTTTCCATGATCTGGG - Intergenic
961228807 3:125281173-125281195 ATGTTTCCCTTCCATGACTTTGG - Intronic
961804857 3:129482104-129482126 CTGTTTCCTTCCCACGCTGTAGG - Intronic
963295544 3:143542099-143542121 AGGTGTTCTTGCCATGATGTGGG + Intronic
963665388 3:148178891-148178913 AGGTTCCCTTGCCATTTTGTTGG - Intergenic
1202748125 3_GL000221v1_random:128795-128817 ATGTTTTCTAGGAATGATGTTGG + Intergenic
968683891 4:1943111-1943133 ATGTTTCATTGTCTTAATGTCGG + Intronic
971947789 4:33304082-33304104 AGGTTTTCCTGCCTTGATGTGGG - Intergenic
975200856 4:71587067-71587089 TTGCTTACTTGCCATGATATAGG - Intergenic
976806786 4:89056821-89056843 ATTTTTCCTTCCCAGGAGGTGGG - Intronic
976893993 4:90085154-90085176 CTGTCTCCTCGCCATGACGTGGG - Intergenic
976931122 4:90568331-90568353 ATGTTTAATTGCTATGCTGTTGG + Intronic
977721744 4:100246971-100246993 CTGTTTCCTGGCCAGGATATGGG + Intergenic
978061869 4:104348990-104349012 GTATTTCCATGACATGATGTAGG + Intergenic
978082089 4:104606015-104606037 ATGTTGCCTTGCCTTCTTGTGGG + Intergenic
978167719 4:105628798-105628820 ATTTTTCCTTTTCATGATGTGGG - Intronic
978361315 4:107933065-107933087 ATCTTTCTTTGCCATGTTATAGG - Intronic
978995435 4:115144973-115144995 AGGTTTACTGGCCATGCTGTTGG - Intergenic
979404748 4:120295770-120295792 ATTTTTCCTAGCCATAGTGTTGG - Intergenic
980684207 4:136203950-136203972 CTTTTTCCTTTCCATGATGTGGG + Intergenic
982226039 4:153167506-153167528 TTGTTTCTTTGCCATTTTGTTGG - Intronic
982572866 4:157073029-157073051 CTGTTTCCTTGCTAAAATGTAGG - Intergenic
983384070 4:167035680-167035702 ATGTTTCCTAGCCAGGATTCGGG - Intronic
984734294 4:183096746-183096768 ATGTTTCCTTGCCAGTCAGTGGG + Intergenic
1202753657 4_GL000008v2_random:34636-34658 ATGTTTTCTAGGAATGATGTTGG - Intergenic
985911567 5:2887798-2887820 ATGTGGCCTTGCCACCATGTGGG + Intergenic
987215797 5:15735485-15735507 ATGTTTCCTCTCCATGATCATGG - Intronic
987712748 5:21523543-21523565 AGTTTTCCTTGCAGTGATGTTGG - Intergenic
991354270 5:65751337-65751359 ATGTTTACTTGTGATGATGAGGG + Intronic
994186549 5:96821606-96821628 AGGTTTCCTTGCTTTGATGTTGG - Intronic
994949934 5:106448635-106448657 ATGTTTTCTTGTAATGATGGAGG - Intergenic
996343234 5:122461289-122461311 TTGATGCTTTGCCATGATGTGGG + Intronic
998892531 5:146761844-146761866 ATGTTTCCCTGGCTTGATGAGGG + Intronic
999572257 5:152933006-152933028 ATTTTTCTCTGCCATGAAGTTGG + Intergenic
1000162395 5:158611634-158611656 ATTTTTCCTTGCTGAGATGTTGG + Intergenic
1003097740 6:3155993-3156015 ATCCTTGCTTTCCATGATGTGGG - Intronic
1003101471 6:3179553-3179575 ATCCTTGCTTTCCATGATGTGGG - Intergenic
1004635091 6:17459393-17459415 GTGATTCCTTGCCATCATATTGG - Intronic
1005012872 6:21352644-21352666 CTGTTTTCTTGACATTATGTGGG - Intergenic
1005194019 6:23261237-23261259 ATGCTTCCAAGCCATGGTGTAGG - Intergenic
1005716038 6:28549568-28549590 AGCTTTCCTTCCCATGAAGTTGG + Intergenic
1007506985 6:42343182-42343204 ATGTTTTCTTACCATCTTGTGGG - Intronic
1007918274 6:45582927-45582949 GTGTTGCCTTTCCATGATATTGG + Intronic
1009003971 6:57758376-57758398 AGTTTTCCTTGCAGTGATGTTGG + Intergenic
1010372318 6:75125013-75125035 ATGTTTCCTCAGCATTATGTAGG - Intronic
1011674389 6:89717738-89717760 ATGTTTGCTGGCCAAGAAGTGGG + Intronic
1012069779 6:94599523-94599545 TTGTTTCATTGGCATGAAGTTGG + Intergenic
1013612624 6:111809174-111809196 ATGTTTGTTTGCCAAGATGGAGG - Intronic
1013792399 6:113852510-113852532 ATGTTTCCATTGCATGTTGTAGG - Intergenic
1014259341 6:119197970-119197992 CTGTTTCCTTCCTATGATTTAGG - Intronic
1020182983 7:5936594-5936616 GTGTTTCCTGGCCATGATCCAGG - Intronic
1020299929 7:6788163-6788185 GTGTTTCCTGGCCATGATCCAGG + Intronic
1022478339 7:30726629-30726651 AGGTGTCCTAGCCATGGTGTAGG + Intronic
1023292893 7:38686440-38686462 ATGTTCGCTTGCCATGGTCTTGG + Exonic
1023295030 7:38705963-38705985 TTGTTTACTTGCCCTGATTTTGG + Intergenic
1023484524 7:40670809-40670831 ATGTTCCCTTGCAATCATCTGGG - Intronic
1028769873 7:94606346-94606368 AAGTTTCCTTGCTGTGAGGTTGG - Intronic
1031535995 7:122933548-122933570 ATTTTTCCTTGTCCTGATTTTGG + Intergenic
1032915510 7:136484589-136484611 CTGTTTCCCTGCCATGATAAGGG - Intergenic
1033424445 7:141231265-141231287 AGGTTTCTTTGCCATGCTTTGGG + Intronic
1035085340 7:156253257-156253279 ATGTTTGGTTGCCATAACGTGGG + Intergenic
1037583806 8:20262700-20262722 ATTTTTGCTTGTCATGATGGGGG + Intronic
1038068865 8:23991732-23991754 AAGCTTTCTTGCCATGATGCAGG + Intergenic
1042635033 8:70864957-70864979 ATGCTTCCTTGCCTGGATGAAGG - Intergenic
1045460499 8:102421292-102421314 ATGTTTAGATGCCATGAAGTAGG - Intergenic
1046412081 8:113859019-113859041 ATGTTTCCAAGACATGACGTTGG + Intergenic
1049940158 9:537728-537750 ATTTTTGGTTGCCATGATTTTGG + Intronic
1050681591 9:8117770-8117792 ATGATTACTTGCCATTATGCGGG - Intergenic
1055835117 9:80430854-80430876 ATGCTTCCTTGCCCTTATTTGGG - Intergenic
1058130152 9:101242522-101242544 TTGCTTCTTTGACATGATGTTGG + Intronic
1058752195 9:108050550-108050572 AGATTTCCTTGCCATGTTATAGG + Intergenic
1203757381 Un_GL000218v1:146205-146227 ATGTTTTCTAGGAATGATGTTGG + Intergenic
1203716765 Un_KI270742v1:158877-158899 ATGTTTTCTAGGAATGATGTTGG + Intergenic
1203534447 Un_KI270743v1:19359-19381 ATGTTTTCTAGGAATGATGTTGG - Intergenic
1186595899 X:10981100-10981122 ATGTGTCCTCCCCATGCTGTGGG - Intergenic
1190626010 X:52339413-52339435 ATGCTTCCTTGCCAGGGTGGAGG - Intergenic
1192127701 X:68517468-68517490 ATGTTTGCTAGACCTGATGTTGG + Intronic
1195138651 X:101935868-101935890 TTGTTTCCTTTCTATGATTTGGG - Intergenic
1195334037 X:103832060-103832082 CTGTTTCCTTCCCATTGTGTTGG - Exonic
1195924950 X:110015889-110015911 ATGTTTCCTTGCTTGCATGTGGG + Intronic
1198279350 X:135126537-135126559 AGGTCTCCTTCCCAGGATGTGGG + Intergenic
1198291607 X:135245983-135246005 AGGTCTCCTTCCCAGGATGTGGG - Intergenic
1199882235 X:151982994-151983016 ATGCTTGCTTGCCCTGCTGTAGG + Intergenic
1200327169 X:155252910-155252932 ATATTTCCCTCTCATGATGTAGG - Intergenic
1200392149 X:155955650-155955672 ATAATTCCATGCCATGATTTTGG - Intergenic
1200400241 X:156015644-156015666 ATTTTTCCATGCCGTGATTTTGG + Intergenic
1201170963 Y:11263824-11263846 ATGTTTTCTAGGAATGATGTTGG + Intergenic