ID: 1126095567

View in Genome Browser
Species Human (GRCh38)
Location 15:45087286-45087308
Sequence AACAAGAGCCGCACCTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126095567_1126095573 24 Left 1126095567 15:45087286-45087308 CCTGATGAGGTGCGGCTCTTGTT No data
Right 1126095573 15:45087333-45087355 TTCCATATCACACTGGGTGTTGG No data
1126095567_1126095572 18 Left 1126095567 15:45087286-45087308 CCTGATGAGGTGCGGCTCTTGTT No data
Right 1126095572 15:45087327-45087349 TGTTGTTTCCATATCACACTGGG No data
1126095567_1126095569 -5 Left 1126095567 15:45087286-45087308 CCTGATGAGGTGCGGCTCTTGTT No data
Right 1126095569 15:45087304-45087326 TTGTTTTCCAGAACGACAGTGGG No data
1126095567_1126095571 17 Left 1126095567 15:45087286-45087308 CCTGATGAGGTGCGGCTCTTGTT No data
Right 1126095571 15:45087326-45087348 GTGTTGTTTCCATATCACACTGG No data
1126095567_1126095568 -6 Left 1126095567 15:45087286-45087308 CCTGATGAGGTGCGGCTCTTGTT No data
Right 1126095568 15:45087303-45087325 CTTGTTTTCCAGAACGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126095567 Original CRISPR AACAAGAGCCGCACCTCATC AGG (reversed) Intergenic
No off target data available for this crispr