ID: 1126095568

View in Genome Browser
Species Human (GRCh38)
Location 15:45087303-45087325
Sequence CTTGTTTTCCAGAACGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126095562_1126095568 23 Left 1126095562 15:45087257-45087279 CCTTCCAAAGATGTCAGCCTCTT No data
Right 1126095568 15:45087303-45087325 CTTGTTTTCCAGAACGACAGTGG No data
1126095563_1126095568 19 Left 1126095563 15:45087261-45087283 CCAAAGATGTCAGCCTCTTCTGA No data
Right 1126095568 15:45087303-45087325 CTTGTTTTCCAGAACGACAGTGG No data
1126095567_1126095568 -6 Left 1126095567 15:45087286-45087308 CCTGATGAGGTGCGGCTCTTGTT No data
Right 1126095568 15:45087303-45087325 CTTGTTTTCCAGAACGACAGTGG No data
1126095565_1126095568 6 Left 1126095565 15:45087274-45087296 CCTCTTCTGAGTCCTGATGAGGT No data
Right 1126095568 15:45087303-45087325 CTTGTTTTCCAGAACGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126095568 Original CRISPR CTTGTTTTCCAGAACGACAG TGG Intergenic