ID: 1126095570

View in Genome Browser
Species Human (GRCh38)
Location 15:45087311-45087333
Sequence AACAACACCCACTGTCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126095570_1126095576 18 Left 1126095570 15:45087311-45087333 CCAGAACGACAGTGGGTGTTGTT No data
Right 1126095576 15:45087352-45087374 TTGGCAGATCCAAAGGTAAGAGG No data
1126095570_1126095573 -1 Left 1126095570 15:45087311-45087333 CCAGAACGACAGTGGGTGTTGTT No data
Right 1126095573 15:45087333-45087355 TTCCATATCACACTGGGTGTTGG No data
1126095570_1126095572 -7 Left 1126095570 15:45087311-45087333 CCAGAACGACAGTGGGTGTTGTT No data
Right 1126095572 15:45087327-45087349 TGTTGTTTCCATATCACACTGGG No data
1126095570_1126095575 11 Left 1126095570 15:45087311-45087333 CCAGAACGACAGTGGGTGTTGTT No data
Right 1126095575 15:45087345-45087367 CTGGGTGTTGGCAGATCCAAAGG No data
1126095570_1126095571 -8 Left 1126095570 15:45087311-45087333 CCAGAACGACAGTGGGTGTTGTT No data
Right 1126095571 15:45087326-45087348 GTGTTGTTTCCATATCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126095570 Original CRISPR AACAACACCCACTGTCGTTC TGG (reversed) Intergenic
No off target data available for this crispr