ID: 1126095571 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:45087326-45087348 |
Sequence | GTGTTGTTTCCATATCACAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1126095567_1126095571 | 17 | Left | 1126095567 | 15:45087286-45087308 | CCTGATGAGGTGCGGCTCTTGTT | No data | ||
Right | 1126095571 | 15:45087326-45087348 | GTGTTGTTTCCATATCACACTGG | No data | ||||
1126095565_1126095571 | 29 | Left | 1126095565 | 15:45087274-45087296 | CCTCTTCTGAGTCCTGATGAGGT | No data | ||
Right | 1126095571 | 15:45087326-45087348 | GTGTTGTTTCCATATCACACTGG | No data | ||||
1126095570_1126095571 | -8 | Left | 1126095570 | 15:45087311-45087333 | CCAGAACGACAGTGGGTGTTGTT | No data | ||
Right | 1126095571 | 15:45087326-45087348 | GTGTTGTTTCCATATCACACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1126095571 | Original CRISPR | GTGTTGTTTCCATATCACAC TGG | Intergenic | ||