ID: 1126095571

View in Genome Browser
Species Human (GRCh38)
Location 15:45087326-45087348
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126095567_1126095571 17 Left 1126095567 15:45087286-45087308 CCTGATGAGGTGCGGCTCTTGTT No data
Right 1126095571 15:45087326-45087348 GTGTTGTTTCCATATCACACTGG No data
1126095565_1126095571 29 Left 1126095565 15:45087274-45087296 CCTCTTCTGAGTCCTGATGAGGT No data
Right 1126095571 15:45087326-45087348 GTGTTGTTTCCATATCACACTGG No data
1126095570_1126095571 -8 Left 1126095570 15:45087311-45087333 CCAGAACGACAGTGGGTGTTGTT No data
Right 1126095571 15:45087326-45087348 GTGTTGTTTCCATATCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126095571 Original CRISPR GTGTTGTTTCCATATCACAC TGG Intergenic