ID: 1126095571 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:45087326-45087348 |
| Sequence | GTGTTGTTTCCATATCACAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1126095567_1126095571 | 17 | Left | 1126095567 | 15:45087286-45087308 | CCTGATGAGGTGCGGCTCTTGTT | No data | ||
| Right | 1126095571 | 15:45087326-45087348 | GTGTTGTTTCCATATCACACTGG | No data | ||||
| 1126095565_1126095571 | 29 | Left | 1126095565 | 15:45087274-45087296 | CCTCTTCTGAGTCCTGATGAGGT | No data | ||
| Right | 1126095571 | 15:45087326-45087348 | GTGTTGTTTCCATATCACACTGG | No data | ||||
| 1126095570_1126095571 | -8 | Left | 1126095570 | 15:45087311-45087333 | CCAGAACGACAGTGGGTGTTGTT | No data | ||
| Right | 1126095571 | 15:45087326-45087348 | GTGTTGTTTCCATATCACACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1126095571 | Original CRISPR | GTGTTGTTTCCATATCACAC TGG | Intergenic | ||