ID: 1126095968

View in Genome Browser
Species Human (GRCh38)
Location 15:45090983-45091005
Sequence AGGAGAACATTGCTAAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126095968_1126095969 -10 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095969 15:45090996-45091018 ATGTTCTCCTCTTTCACTTGAGG No data
1126095968_1126095977 22 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095977 15:45091028-45091050 GGGCTGGAAAGTTGGAAAAAGGG No data
1126095968_1126095978 23 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095978 15:45091029-45091051 GGCTGGAAAGTTGGAAAAAGGGG No data
1126095968_1126095972 1 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095972 15:45091007-45091029 TTTCACTTGAGGCAGAAGTTGGG No data
1126095968_1126095976 21 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095976 15:45091027-45091049 GGGGCTGGAAAGTTGGAAAAAGG No data
1126095968_1126095974 6 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095974 15:45091012-45091034 CTTGAGGCAGAAGTTGGGGCTGG No data
1126095968_1126095975 14 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095975 15:45091020-45091042 AGAAGTTGGGGCTGGAAAGTTGG No data
1126095968_1126095971 0 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095971 15:45091006-45091028 CTTTCACTTGAGGCAGAAGTTGG No data
1126095968_1126095973 2 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095973 15:45091008-45091030 TTCACTTGAGGCAGAAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126095968 Original CRISPR AGGAGAACATTGCTAAGATG TGG (reversed) Intergenic
No off target data available for this crispr