ID: 1126095970

View in Genome Browser
Species Human (GRCh38)
Location 15:45091003-45091025
Sequence ACTTCTGCCTCAAGTGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126095970_1126095976 1 Left 1126095970 15:45091003-45091025 CCTCTTTCACTTGAGGCAGAAGT No data
Right 1126095976 15:45091027-45091049 GGGGCTGGAAAGTTGGAAAAAGG No data
1126095970_1126095977 2 Left 1126095970 15:45091003-45091025 CCTCTTTCACTTGAGGCAGAAGT No data
Right 1126095977 15:45091028-45091050 GGGCTGGAAAGTTGGAAAAAGGG No data
1126095970_1126095975 -6 Left 1126095970 15:45091003-45091025 CCTCTTTCACTTGAGGCAGAAGT No data
Right 1126095975 15:45091020-45091042 AGAAGTTGGGGCTGGAAAGTTGG No data
1126095970_1126095978 3 Left 1126095970 15:45091003-45091025 CCTCTTTCACTTGAGGCAGAAGT No data
Right 1126095978 15:45091029-45091051 GGCTGGAAAGTTGGAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126095970 Original CRISPR ACTTCTGCCTCAAGTGAAAG AGG (reversed) Intergenic
No off target data available for this crispr