ID: 1126095978

View in Genome Browser
Species Human (GRCh38)
Location 15:45091029-45091051
Sequence GGCTGGAAAGTTGGAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126095970_1126095978 3 Left 1126095970 15:45091003-45091025 CCTCTTTCACTTGAGGCAGAAGT No data
Right 1126095978 15:45091029-45091051 GGCTGGAAAGTTGGAAAAAGGGG No data
1126095968_1126095978 23 Left 1126095968 15:45090983-45091005 CCACATCTTAGCAATGTTCTCCT No data
Right 1126095978 15:45091029-45091051 GGCTGGAAAGTTGGAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126095978 Original CRISPR GGCTGGAAAGTTGGAAAAAG GGG Intergenic
No off target data available for this crispr