ID: 1126096792

View in Genome Browser
Species Human (GRCh38)
Location 15:45095814-45095836
Sequence TACCCAAAGGTGCCCGTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126096792_1126096797 3 Left 1126096792 15:45095814-45095836 CCAGTGACGGGCACCTTTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 48
Right 1126096797 15:45095840-45095862 AGCACAGCCATTGCCCTTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 161
1126096792_1126096795 1 Left 1126096792 15:45095814-45095836 CCAGTGACGGGCACCTTTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 48
Right 1126096795 15:45095838-45095860 CCAGCACAGCCATTGCCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 207
1126096792_1126096802 30 Left 1126096792 15:45095814-45095836 CCAGTGACGGGCACCTTTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 48
Right 1126096802 15:45095867-45095889 GTAGATCTCCCTGAGGCGAGTGG 0: 2
1: 0
2: 0
3: 1
4: 55
1126096792_1126096801 23 Left 1126096792 15:45095814-45095836 CCAGTGACGGGCACCTTTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 48
Right 1126096801 15:45095860-45095882 GGGATGAGTAGATCTCCCTGAGG 0: 1
1: 1
2: 0
3: 11
4: 113
1126096792_1126096796 2 Left 1126096792 15:45095814-45095836 CCAGTGACGGGCACCTTTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 48
Right 1126096796 15:45095839-45095861 CAGCACAGCCATTGCCCTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126096792 Original CRISPR TACCCAAAGGTGCCCGTCAC TGG (reversed) Exonic
900289756 1:1918921-1918943 TCCCCACAGGTGCCCGCCCCAGG - Exonic
915957922 1:160238679-160238701 TACTCGAACCTGCCCGTCACGGG + Exonic
923209568 1:231790987-231791009 AATGCAAAGGTGCCTGTCACCGG - Intronic
1078430678 11:11285915-11285937 TAGCCAAAGTTGCCTGTCAAGGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1085502422 11:77036174-77036196 TCCCCAAATGTGCCAGGCACAGG + Intronic
1086863129 11:91948419-91948441 TGCCCATAGGTACCTGTCACTGG + Intergenic
1087846340 11:102977809-102977831 GACCCAAAGGTGACCGTTATAGG - Intergenic
1091586701 12:1820988-1821010 ATCCCAAAGGTGCACGACACTGG + Intronic
1095750972 12:45710990-45711012 TACACAAATGTGCCTGGCACAGG + Intergenic
1101742235 12:107509641-107509663 TTCCCAAAGGAGCTCATCACTGG + Intronic
1103314831 12:120044426-120044448 TACCCTAAGGAGCCCTTCACTGG - Intronic
1105357263 13:19669891-19669913 CACCCAAAGATGCCCACCACAGG + Intronic
1110626692 13:77661664-77661686 CACCCAAAGCTGCCGGCCACAGG - Intergenic
1110871040 13:80452531-80452553 TACCCACATGTGCCCCTCAGGGG + Intergenic
1117566490 14:56999175-56999197 TGCCCAAAGGAGCCTGTCCCAGG - Intergenic
1125318809 15:38459728-38459750 TACCCAAGGGAGCCCATCTCCGG - Intronic
1126096792 15:45095814-45095836 TACCCAAAGGTGCCCGTCACTGG - Exonic
1126108424 15:45161962-45161984 TACCCAAAGGTACCAGACCCTGG + Exonic
1139302285 16:65955661-65955683 TCCCCAAAGGTGCAGGTCCCAGG + Intergenic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1157574679 18:48735770-48735792 TACCCAAAGGTGCCTGGGTCTGG + Intronic
928410242 2:31048916-31048938 TTCCCACAGGTGCCCGTCACTGG + Intronic
933346050 2:81086944-81086966 TACCCACAGGTGCTACTCACTGG + Intergenic
1170652769 20:18257705-18257727 TTCCCAAAGGCGCCAGTCATGGG + Intergenic
1172827946 20:37806217-37806239 TACCCCTAGGTGCTTGTCACAGG - Intronic
1173416501 20:42861231-42861253 TTCCCAAAGTTGCCAGTCCCTGG + Intronic
1173476648 20:43364408-43364430 CACCCCTAGGTGCCCTTCACAGG - Intergenic
963271142 3:143286861-143286883 GACCCAAAGGTGACCTGCACTGG - Intronic
970050911 4:11914092-11914114 TACCCAACTGTGCCAGCCACAGG - Intergenic
970232820 4:13928312-13928334 AAGCCAAAGTTGCCCGTCAGAGG + Intergenic
979597440 4:122549682-122549704 AACCCAAAGGTGGCTGTCATTGG - Intergenic
981979370 4:150772694-150772716 TACCTAAAGGGGCCCGTCAAAGG + Intronic
983476962 4:168224898-168224920 TACAAAAAGGTGACCATCACAGG - Intronic
984731097 4:183068971-183068993 GAGCCAAAGGTGCCCATCAGAGG + Intergenic
985768702 5:1795776-1795798 TATCCACAGATGCTCGTCACTGG - Intergenic
987814228 5:22879818-22879840 TACCCAAAGGTTGCCGTCTTTGG - Intergenic
988883176 5:35527502-35527524 AACCCAAAGGTGAGTGTCACAGG + Intergenic
1002093417 5:176817591-176817613 CAAACAAATGTGCCCGTCACTGG + Intronic
1002891546 6:1337006-1337028 AACCCAAAGGTGCCAGTTAATGG + Intergenic
1004791882 6:19035587-19035609 TAACAAAAGGTGCCCGTGAAAGG + Intergenic
1007095103 6:39208084-39208106 TACCCTAAGCTGCCAGCCACAGG - Intronic
1020132005 7:5563803-5563825 TGCCCAAAGGGCCCCATCACCGG - Intergenic
1020529538 7:9314553-9314575 GAGCCAAAGTTGCCTGTCACAGG - Intergenic
1022232443 7:28427620-28427642 TTCCCCACGGTGCCTGTCACAGG + Intronic
1032011749 7:128351850-128351872 AGCCCGAAGGTGCCCGCCACCGG + Exonic
1034889087 7:154823692-154823714 TACACAAATGTGCCTATCACTGG - Intronic
1035132433 7:156668490-156668512 GACCCACAGGTGCAAGTCACTGG - Intronic
1039880785 8:41624309-41624331 CACCCAAAAATGCCTGTCACTGG - Exonic
1049447331 8:142637322-142637344 TCCCCAAAGGTGCCCAGCCCAGG - Intergenic
1051634313 9:19167650-19167672 CACCAAAAGGTGCCCGTCAATGG - Intergenic
1061130052 9:128703450-128703472 TACCCAAAGGTTCCCGCCCTGGG - Intronic
1192236268 X:69298019-69298041 CCCCCAAATGTGCCCGGCACTGG - Intergenic
1192547848 X:72028466-72028488 TGCCTATTGGTGCCCGTCACTGG + Intergenic
1201619610 Y:15941607-15941629 TACACAATGGTGCCTGTCAGAGG - Intergenic