ID: 1126098558 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:45106163-45106185 |
Sequence | GGCATCCTCGGTTGTTGGAC AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 39 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 6, 4: 31} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1126098552_1126098558 | 4 | Left | 1126098552 | 15:45106136-45106158 | CCTTAGGGATCTTGAGCAGCAGG | 0: 1 1: 0 2: 5 3: 20 4: 156 |
||
Right | 1126098558 | 15:45106163-45106185 | GGCATCCTCGGTTGTTGGACAGG | 0: 1 1: 0 2: 1 3: 6 4: 31 |
||||
1126098551_1126098558 | 16 | Left | 1126098551 | 15:45106124-45106146 | CCAGGTCATACTCCTTAGGGATC | 0: 1 1: 1 2: 0 3: 5 4: 52 |
||
Right | 1126098558 | 15:45106163-45106185 | GGCATCCTCGGTTGTTGGACAGG | 0: 1 1: 0 2: 1 3: 6 4: 31 |
||||
1126098548_1126098558 | 21 | Left | 1126098548 | 15:45106119-45106141 | CCATACCAGGTCATACTCCTTAG | 0: 1 1: 1 2: 2 3: 7 4: 96 |
||
Right | 1126098558 | 15:45106163-45106185 | GGCATCCTCGGTTGTTGGACAGG | 0: 1 1: 0 2: 1 3: 6 4: 31 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1126098558 | Original CRISPR | GGCATCCTCGGTTGTTGGAC AGG | Exonic | ||