ID: 1126098558

View in Genome Browser
Species Human (GRCh38)
Location 15:45106163-45106185
Sequence GGCATCCTCGGTTGTTGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126098552_1126098558 4 Left 1126098552 15:45106136-45106158 CCTTAGGGATCTTGAGCAGCAGG 0: 1
1: 0
2: 5
3: 20
4: 156
Right 1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG 0: 1
1: 0
2: 1
3: 6
4: 31
1126098551_1126098558 16 Left 1126098551 15:45106124-45106146 CCAGGTCATACTCCTTAGGGATC 0: 1
1: 1
2: 0
3: 5
4: 52
Right 1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG 0: 1
1: 0
2: 1
3: 6
4: 31
1126098548_1126098558 21 Left 1126098548 15:45106119-45106141 CCATACCAGGTCATACTCCTTAG 0: 1
1: 1
2: 2
3: 7
4: 96
Right 1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG 0: 1
1: 0
2: 1
3: 6
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126098558 Original CRISPR GGCATCCTCGGTTGTTGGAC AGG Exonic