ID: 1126098558

View in Genome Browser
Species Human (GRCh38)
Location 15:45106163-45106185
Sequence GGCATCCTCGGTTGTTGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126098551_1126098558 16 Left 1126098551 15:45106124-45106146 CCAGGTCATACTCCTTAGGGATC 0: 1
1: 1
2: 0
3: 5
4: 52
Right 1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG 0: 1
1: 0
2: 1
3: 6
4: 31
1126098552_1126098558 4 Left 1126098552 15:45106136-45106158 CCTTAGGGATCTTGAGCAGCAGG 0: 1
1: 0
2: 5
3: 20
4: 156
Right 1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG 0: 1
1: 0
2: 1
3: 6
4: 31
1126098548_1126098558 21 Left 1126098548 15:45106119-45106141 CCATACCAGGTCATACTCCTTAG 0: 1
1: 1
2: 2
3: 7
4: 96
Right 1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG 0: 1
1: 0
2: 1
3: 6
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126098558 Original CRISPR GGCATCCTCGGTTGTTGGAC AGG Exonic
901021586 1:6258732-6258754 GGCAGCCTCGGCTGTGAGACTGG + Intronic
907314391 1:53559290-53559312 GGCCTCCTGGCTTGGTGGACTGG + Intronic
1090707464 11:129351994-129352016 GGAATACTCTGTTGTTGAACTGG - Intergenic
1109058450 13:57582202-57582224 GGCATCCTCTGTGGTAGGACAGG + Intergenic
1122945889 14:105008933-105008955 GGCATTCTTGGTTTTTTGACAGG - Intronic
1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG + Exonic
1126105450 15:45144175-45144197 GGCGTCCACGGTTGCTGGACAGG - Exonic
1128871901 15:71165576-71165598 TGGATCCTGGGTTGTTGGTCGGG + Intronic
1141852966 16:86660080-86660102 GGCATCCTAGGATGGTGCACAGG - Intergenic
1148845836 17:50529307-50529329 GGCATCCTCGTGTGTGAGACAGG + Intronic
1151531023 17:74704770-74704792 GCCATTCACTGTTGTTGGACCGG + Exonic
1163049397 19:14670593-14670615 GACATCATCGGATGTTGGAAAGG - Intronic
1171512107 20:25694592-25694614 GGCTTCCTCGGTTATTGGAGTGG - Intronic
1174363127 20:50040815-50040837 GGCATCCCAGGTTGCAGGACTGG + Intergenic
1174556824 20:51401455-51401477 GGTATCCTTGGTTATTGGAATGG - Intronic
953916158 3:46922406-46922428 GTCATGCTCGGTTGCTGGAGGGG + Intronic
956303953 3:67804167-67804189 GGCATCCTGGGTAGCTGGAGTGG + Intergenic
957370374 3:79286501-79286523 GTCATCCTTTGTTGTTGGACTGG - Intronic
959443746 3:106412128-106412150 GGAATCCTTGGTTCTTAGACAGG - Intergenic
964720308 3:159763636-159763658 GGCATGCTCGGTGGCGGGACCGG + Intronic
965732775 3:171790286-171790308 GGCTTCCTCAATTGTGGGACTGG - Intronic
971608613 4:28691630-28691652 GGCTTCCTCAGTTGTTGGGCTGG - Intergenic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
987182990 5:15386143-15386165 GGCCTCCTCTGTTGGTGGCCTGG - Intergenic
993508345 5:88739374-88739396 AGCATACTGGGTTGTTAGACAGG + Intronic
1008030088 6:46685949-46685971 GTCATGCTCTGCTGTTGGACAGG - Intergenic
1010236509 6:73579470-73579492 GGCATCCTGGGCTGTGGGGCTGG + Intergenic
1019481940 7:1270887-1270909 GGGATCCTGGGTTCCTGGACAGG - Intergenic
1027197898 7:76043713-76043735 GGCATCCTGTGTTGGTGGAGGGG - Intronic
1040578464 8:48675086-48675108 GGCCTCCTCGGTTATTGGAAAGG + Intergenic
1043597309 8:81901157-81901179 GACTTCTTCGGTTTTTGGACAGG + Intergenic
1044362198 8:91300105-91300127 GGCATCCTCTGTTCTTGGACAGG - Intronic
1047068194 8:121310994-121311016 GGTATCCTGGGTTGATGGATTGG - Intergenic
1048360046 8:133689839-133689861 GGCAGCCTCGAGTGATGGACAGG + Intergenic
1054951245 9:70854351-70854373 AGCATCCTCTGTTGTTAAACAGG + Intronic
1055176853 9:73329285-73329307 GACATCCTCTGTTCATGGACTGG - Intergenic
1188440202 X:30208930-30208952 GGCATCCTCTGTTGTGGGGTGGG - Intergenic
1196760195 X:119193964-119193986 GGCCTCCTCGGTTTTTGGGTGGG - Intergenic
1198966064 X:142229645-142229667 GGCATGTCCGGTTTTTGGACAGG - Intergenic