ID: 1126105000

View in Genome Browser
Species Human (GRCh38)
Location 15:45141662-45141684
Sequence CATTCGGCTGAGATGGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126105000 Original CRISPR CATTCGGCTGAGATGGAGCT CGG Intronic
901292662 1:8136348-8136370 ATTTCGGCAGAGATGGAGCTTGG - Intergenic
903557235 1:24202791-24202813 CAGGAGGCTGAGATGGGGCTCGG + Intergenic
908669941 1:66534619-66534641 CAGGGAGCTGAGATGGAGCTAGG + Intronic
908736633 1:67283435-67283457 AATTTGGTTGAGATGGAGCAGGG - Intergenic
911218289 1:95219352-95219374 CATTAGGCTGAGAGGGCTCTGGG + Intronic
912698717 1:111860593-111860615 GATAGGGCTGAGAGGGAGCTTGG - Intronic
913557907 1:119987424-119987446 CATTAGTCTGGTATGGAGCTGGG - Intronic
920385807 1:205569448-205569470 TCTTCGGCCAAGATGGAGCTGGG - Intronic
1063220416 10:3961933-3961955 CATTCGGGTGCTCTGGAGCTGGG + Intergenic
1067909548 10:50332193-50332215 CATTGGGCTGAGATAGAGCCTGG - Intronic
1068829160 10:61473144-61473166 CCTTCTGCTGAGATGGAGAAGGG + Intergenic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1071055564 10:81504793-81504815 CCTATGGCTGAGATGGAGCAGGG - Intergenic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1072916221 10:99538834-99538856 CCTTCGGCTGGGTTGGAGATGGG - Intergenic
1075816749 10:125270537-125270559 CATCCTGCTGAGCTGCAGCTGGG + Intergenic
1080575563 11:33596108-33596130 CATTCTGAGGACATGGAGCTGGG - Intronic
1083035189 11:59630363-59630385 CAGGAGGCTGAGATGGAGGTTGG + Intergenic
1084487409 11:69456946-69456968 CTTTTGGCTGAGATTCAGCTGGG - Intergenic
1084792559 11:71483788-71483810 CGTTCATCTGAGATGGACCTTGG - Intronic
1089124574 11:116167787-116167809 CCTTCGGCTCAGATGGAGCAGGG - Intergenic
1090080488 11:123609241-123609263 CATGCAGCTAAGAAGGAGCTAGG + Intronic
1092236519 12:6814137-6814159 CATTCAGCTTGGATGGACCTGGG - Exonic
1100098906 12:91078118-91078140 CTTTTGGATGAGATAGAGCTGGG + Intergenic
1103050817 12:117778158-117778180 CAGTCAGCTGAGATGGTGCTTGG - Intronic
1108507220 13:51123337-51123359 CAATCTGTTGAGATGAAGCTTGG - Intergenic
1111998931 13:95192316-95192338 CCTGCGGCTGAGAGGGTGCTGGG - Intronic
1114735681 14:25041427-25041449 CCTGCTGCTGAGAAGGAGCTGGG - Intronic
1115453872 14:33578973-33578995 CATACTGCTGACATTGAGCTTGG - Intronic
1118469812 14:66065458-66065480 CATTAGACTGAGAAGGGGCTGGG + Intergenic
1122539958 14:102492612-102492634 CATCGGGCTGGGCTGGAGCTGGG + Intronic
1125236944 15:37525514-37525536 AATTCAGCTGAGAGGGTGCTGGG + Intergenic
1126105000 15:45141662-45141684 CATTCGGCTGAGATGGAGCTCGG + Intronic
1135940931 16:26821158-26821180 CATTGGTCTGAGAGGGAGGTGGG + Intergenic
1137546202 16:49405345-49405367 CATTCAGCTCAGCTGGGGCTGGG - Intergenic
1142548243 17:720652-720674 CAGTCGGCTGTGAGGGAGTTGGG + Intronic
1142548263 17:720739-720761 CAGTCGGCTGTGAGGGAGTTGGG + Intronic
1146008637 17:29177969-29177991 CACCCTGCTGAGGTGGAGCTGGG - Intronic
1146595706 17:34166613-34166635 GAATAGGCTGTGATGGAGCTGGG + Intronic
1146615766 17:34356347-34356369 GAATCTGCTGAGCTGGAGCTGGG - Intergenic
1148387333 17:47243688-47243710 GATTGGTCTGAGATGGAGCATGG + Intergenic
1151968663 17:77445687-77445709 CAGTTGGCTGAGTTGGAGGTGGG + Intronic
1158226416 18:55205990-55206012 CATTTGTCTGGGATGGGGCTAGG - Intergenic
1168604316 19:57746441-57746463 CAGGCCGCTGAGATGGAGCTGGG + Intronic
925620450 2:5787175-5787197 CATTGGGCTGAGCTGGGGCGGGG + Intergenic
926163665 2:10505053-10505075 CAGTCAGCTGAGATGGGACTGGG + Intergenic
926936158 2:18088188-18088210 CATTTGGCTCAGATGAAGATTGG - Intronic
930633329 2:53778200-53778222 CATTTGGCTAAGATGGTCCTAGG + Intronic
934696843 2:96406138-96406160 GATTGGGCTGAGCTGGAGATGGG - Intergenic
937930975 2:127205050-127205072 TCTTCGGCTGAGATGGAGAGAGG - Intronic
939373370 2:141331387-141331409 CATTGGGTTGATATGGAGATGGG + Intronic
940291306 2:152079910-152079932 CATTAGGCTGGGATGTGGCTTGG + Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
948615362 2:239195029-239195051 CCTTCTGCTGAGAAGGAGCCTGG + Intronic
948719387 2:239889154-239889176 CCTTTGGGTGAGATGGAGCTGGG - Intergenic
1174189235 20:48728486-48728508 CATTCAGCTCAGCTAGAGCTGGG - Intronic
1174269406 20:49356376-49356398 CACTAGGCTGAGCTGCAGCTTGG + Intergenic
1176887911 21:14278008-14278030 CATGTGACTGAGCTGGAGCTAGG - Intergenic
1180172547 21:46067298-46067320 CATCTGGCTGAAAAGGAGCTCGG + Intergenic
1182512650 22:30830012-30830034 CATGGGGTTGAGCTGGAGCTGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949901730 3:8820744-8820766 CCTCTGGCTGAGATGCAGCTTGG + Intronic
950469305 3:13174687-13174709 CATGGGGGTGACATGGAGCTGGG - Intergenic
950649679 3:14399534-14399556 CACAGGGCTGAGGTGGAGCTAGG + Intergenic
950663572 3:14481745-14481767 CATTGGGCTGGGCTGGAGCCTGG + Exonic
953448338 3:42986567-42986589 AATTTGGCTGGGAAGGAGCTGGG + Intronic
953935430 3:47037697-47037719 CATGAAGCTGAGATGGACCTGGG - Exonic
954977059 3:54706219-54706241 TCTTCAGCTGAGATGGAGTTTGG + Intronic
957520938 3:81317392-81317414 CATTTGGCAGAGAGGGAGTTGGG + Intergenic
967876965 3:194274017-194274039 CATTCAGGTGGCATGGAGCTTGG - Intergenic
968673362 4:1864115-1864137 CTTTGGGCTGAGTGGGAGCTGGG + Intergenic
969097011 4:4741128-4741150 CATTAAGCTGACATGGAGCCTGG - Intergenic
970565012 4:17323468-17323490 CATTTTGCTGTGATGGAGCAGGG - Intergenic
971810268 4:31416332-31416354 CAGTGGGCTGAGATGGAGGGTGG + Intergenic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
975921018 4:79388520-79388542 CCTTGGTCTGAGATTGAGCTTGG + Intergenic
978729373 4:112007051-112007073 CATTGGGTTGAGATGAAGGTGGG - Intergenic
980882061 4:138721097-138721119 GATTTGGCTGAGTTGGAGCACGG + Intergenic
982217018 4:153091262-153091284 CATGGGGCTGAGGTGGAGCCTGG + Intergenic
985026075 4:185740741-185740763 CGTTGGGCTGAGCTGGTGCTGGG - Intronic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
995591852 5:113707682-113707704 TATTCTGCTGAGATGGGTCTTGG + Intergenic
995831479 5:116360188-116360210 CATTTGGCTGAGATGGGGGCAGG + Intronic
997413011 5:133704473-133704495 CATTCAGCTCAGATTGAACTAGG + Intergenic
1000794265 5:165645662-165645684 CATCTGGCTGAAATGGAGCAGGG - Intergenic
1000940654 5:167356122-167356144 CAGTGAGCTGAGATGGAGATGGG + Intronic
1002095057 5:176825728-176825750 CATTTTGCTGCCATGGAGCTGGG - Intronic
1003233334 6:4274212-4274234 CATTAGACTTAGATGGACCTGGG + Intergenic
1015937103 6:138415224-138415246 TTTTAGGCTGAGATGGAGTTAGG - Exonic
1020228483 7:6298716-6298738 CAGTGAGCTGAGATGGAGCCTGG - Intergenic
1023542237 7:41277981-41278003 TAGTCTGCTGATATGGAGCTGGG - Intergenic
1028652419 7:93165530-93165552 CATTAGGCTGAGATGGGTTTAGG + Intergenic
1029233900 7:99096080-99096102 CACTCAGCTGAGGTGAAGCTGGG - Intronic
1029803665 7:102975426-102975448 CAGTAGGCTGAGCAGGAGCTTGG - Intronic
1033981533 7:147171023-147171045 GATTCAGCAGACATGGAGCTGGG - Intronic
1039856467 8:41419265-41419287 CAAGAGGCTGAGATGGAGGTGGG - Intergenic
1043392098 8:79801707-79801729 CATTAGGCTGAGATGGGGATGGG + Intergenic
1045765276 8:105660308-105660330 AATGCAGCTGAGATGGAGTTTGG - Intronic
1049202922 8:141350639-141350661 CACTCTGCTGAGATGGAGTGGGG - Intergenic
1049268059 8:141680081-141680103 CATTCAGCTCAGATGGTGTTTGG - Intergenic
1050265146 9:3882105-3882127 CATTTGGCAGACATGAAGCTAGG + Intronic
1060661196 9:125406194-125406216 CATGGGGCTTAGAGGGAGCTTGG - Intergenic
1193154573 X:78158748-78158770 CCTTCGGTTGGGTTGGAGCTGGG + Intergenic
1202189944 Y:22231372-22231394 CATTAAGCTGAGAAGGAACTGGG + Intergenic