ID: 1126105264

View in Genome Browser
Species Human (GRCh38)
Location 15:45143078-45143100
Sequence ACCTAGGAGGTGGGGACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126105257_1126105264 4 Left 1126105257 15:45143051-45143073 CCCAATCTGAAACAATTGAGCAA 0: 1
1: 3
2: 2
3: 32
4: 246
Right 1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG 0: 1
1: 0
2: 0
3: 24
4: 189
1126105253_1126105264 17 Left 1126105253 15:45143038-45143060 CCCCAGGGACCTTCCCAATCTGA 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG 0: 1
1: 0
2: 0
3: 24
4: 189
1126105258_1126105264 3 Left 1126105258 15:45143052-45143074 CCAATCTGAAACAATTGAGCAAG 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG 0: 1
1: 0
2: 0
3: 24
4: 189
1126105252_1126105264 18 Left 1126105252 15:45143037-45143059 CCCCCAGGGACCTTCCCAATCTG 0: 1
1: 0
2: 1
3: 21
4: 251
Right 1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG 0: 1
1: 0
2: 0
3: 24
4: 189
1126105254_1126105264 16 Left 1126105254 15:45143039-45143061 CCCAGGGACCTTCCCAATCTGAA 0: 1
1: 0
2: 2
3: 11
4: 135
Right 1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG 0: 1
1: 0
2: 0
3: 24
4: 189
1126105256_1126105264 8 Left 1126105256 15:45143047-45143069 CCTTCCCAATCTGAAACAATTGA 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG 0: 1
1: 0
2: 0
3: 24
4: 189
1126105255_1126105264 15 Left 1126105255 15:45143040-45143062 CCAGGGACCTTCCCAATCTGAAA 0: 1
1: 0
2: 3
3: 14
4: 151
Right 1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG 0: 1
1: 0
2: 0
3: 24
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126105264 Original CRISPR ACCTAGGAGGTGGGGACAAT AGG Intronic
902364370 1:15961794-15961816 ACCAGGGAGGTGGGGGGAATGGG + Intronic
905230701 1:36513483-36513505 ACCTAGGTGGATGGGAAAATAGG + Intergenic
907790198 1:57656002-57656024 TCTTAGGAGGTGGGGACTTTAGG + Intronic
909566714 1:77060761-77060783 ACCTAGGAGTAGGGGGCAATTGG - Intronic
909571942 1:77123625-77123647 AGCTGGGAGGAGGGGACACTGGG + Intronic
910162461 1:84288614-84288636 TGCCAGGAAGTGGGGACAATTGG - Intergenic
913351876 1:117870445-117870467 ACCAGAGAGGTGGGGACAAAAGG + Exonic
915145478 1:153793884-153793906 CCCTGGGAGGAGGGGACAGTGGG + Intergenic
919365989 1:196661632-196661654 TATTAGGAGGTGGGGACACTGGG - Intronic
919904066 1:202065711-202065733 ACCTGGGAGGAGAGGAGAATGGG + Intergenic
920361576 1:205420660-205420682 ACCTAGGAGGTTGGGGAGATAGG - Intronic
922073496 1:222219634-222219656 TGCTAGGAGGTTGGGACCATGGG + Intergenic
924452725 1:244192898-244192920 ACCTGGGTGGTAGGTACAATAGG - Intergenic
1064610568 10:17096125-17096147 AGCTGAGAGGTGGGGGCAATAGG + Intronic
1065361017 10:24889073-24889095 TACTAGGAGGTGGGGACTTTGGG + Intronic
1066242745 10:33553932-33553954 ACCTAGGAAGTGTGGACAGAGGG - Intergenic
1067947555 10:50699609-50699631 ACCTAAGAGGTGGGAACAAATGG - Intergenic
1068861574 10:61853349-61853371 AGCTAGGAAGTGGTGACACTCGG + Intergenic
1069579390 10:69554961-69554983 ACCAGGGAGGTGGGGAGAAGTGG - Intergenic
1070284877 10:75075665-75075687 TCCTTGGAGTTGGGAACAATTGG - Intergenic
1070882872 10:79864596-79864618 ACCTAAGAGGTGGGAACAAATGG - Intergenic
1071649437 10:87380899-87380921 ACCTAAGAGGTGGGAACAAATGG - Intergenic
1071712584 10:88064134-88064156 CACTAGGATGTGGGGAGAATTGG - Intergenic
1072016458 10:91351764-91351786 ACCCAGGAGGTTGGGAACATTGG + Intergenic
1072423611 10:95310499-95310521 ATGCAGGGGGTGGGGACAATAGG + Intergenic
1076302374 10:129437853-129437875 GACTAGGATGTGTGGACAATGGG + Intergenic
1076542740 10:131224333-131224355 ACCCAGGAGGATGGGACAGTGGG - Intronic
1077667850 11:4130617-4130639 ACCTAGGAGGTGGAGATTACAGG + Intronic
1077899287 11:6476640-6476662 ACCAAAGGGGTGGGGATAATGGG - Exonic
1078566553 11:12419269-12419291 GCCTGGGGGGTGGGGAGAATGGG - Intronic
1078987782 11:16611872-16611894 ACAAAGGAGGTGGGGAAAAGTGG + Intronic
1079128737 11:17735615-17735637 CCCCGGGAGGTGGGGAAAATGGG - Exonic
1081128181 11:39344259-39344281 ACCTAACAGCTGGGGACATTGGG + Intergenic
1081682687 11:45019336-45019358 TCCTAGGTGGTGGGGACAGGCGG + Intergenic
1081978054 11:47248384-47248406 ACGTATGTGGTGGGGACAACTGG + Intronic
1083844859 11:65325517-65325539 GACTAGGGGGTGGGGAGAATGGG - Intergenic
1084793418 11:71489374-71489396 AGCCAGGAAGTGGGGACCATGGG - Intronic
1085240652 11:75051158-75051180 ACCAAGGAAGTGGGGAAAGTTGG + Intergenic
1086675419 11:89601127-89601149 GCCGAGGAGGTGGGGGAAATGGG - Intergenic
1087725837 11:101715760-101715782 GACTAGGAGGTGGGGCCAATGGG + Intronic
1087781048 11:102301903-102301925 ATCTTGGAGGTGGGGCCAAGTGG - Intergenic
1088608641 11:111556097-111556119 ACCTAAGAGGTGGGGATCATGGG - Intronic
1091142429 11:133246859-133246881 ACCTATTAGGTGGGTAGAATTGG + Intronic
1093583828 12:20813588-20813610 CTCTAGGAGGTGGGAACAACGGG - Intronic
1094668278 12:32543601-32543623 TCCTAAGTGGTGGGGATAATAGG - Intronic
1095667848 12:44823389-44823411 GGCTAGGAGATGGGGAAAATGGG - Intronic
1096565272 12:52473099-52473121 ACCTAGGAGGGAGGGAGAAGGGG - Intronic
1096567293 12:52492550-52492572 ACCTAGGAGGGAGGGAGAAGAGG - Intronic
1102060311 12:109926475-109926497 AGGCAGGAGCTGGGGACAATCGG + Intronic
1103524719 12:121560127-121560149 CCCAAGGAGGTTGGGACTATGGG + Intronic
1104176684 12:126339995-126340017 AACTATGAGGTGGGGAAGATTGG + Intergenic
1104585186 12:130042597-130042619 TCCTTGGGGGTGGGGACAAAAGG - Intergenic
1104847332 12:131853048-131853070 ACCCAGGACGTGGGGACCACGGG - Intergenic
1108114380 13:47111066-47111088 CCCAAGGGGGTTGGGACAATGGG - Intergenic
1110016349 13:70410201-70410223 TCCTAGGAGGTGGGGCCCTTGGG - Intergenic
1110999990 13:82165794-82165816 CACTAGGAGCTGGGGACAAGCGG - Intergenic
1117891662 14:60428371-60428393 AGGTAGGAGGTGGGGATAAAGGG - Intronic
1121033022 14:90675371-90675393 ACTTAGGTGGTGGGGAGAAGGGG + Intronic
1121542945 14:94742058-94742080 ACCCAGGAGGAGGGAACACTTGG + Intergenic
1122452528 14:101821759-101821781 ATCTAGGAGGTGGCGGCAAGTGG + Intronic
1123172569 14:106388537-106388559 ACCTGGGAGGTGAGGGAAATTGG + Intergenic
1124247701 15:28085029-28085051 CACCAGGAGGTGGGGACCATGGG + Intronic
1124834616 15:33183815-33183837 ACTCAGGAGGTGGGGAGAAAGGG + Intronic
1125551101 15:40545504-40545526 ACAGAGGAGGTGGAGAGAATGGG + Intronic
1125981691 15:44008064-44008086 ACTGAGTAGGTGGGGACAATCGG + Intronic
1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG + Intronic
1127139399 15:55959518-55959540 TATTAGGAGGTGGGGATAATAGG - Intronic
1129016056 15:72469940-72469962 TACTAGGACTTGGGGACAATGGG + Intergenic
1131554841 15:93388087-93388109 TCATAGGAGGTGGGGACTTTGGG - Intergenic
1132830252 16:1924488-1924510 ACTTAGGAGCTGGGTACAAAGGG - Intergenic
1133403412 16:5504947-5504969 TCCTAGGGGCTGGGGACGATGGG + Intergenic
1133502473 16:6379011-6379033 ACGTGGGAGGTGAGGAGAATCGG + Intronic
1134075086 16:11285023-11285045 AGCTAGGCGGTGGGGACATTTGG + Intronic
1136231536 16:28888515-28888537 ACCCAGGAGGCTGGGACAAGAGG - Intronic
1136556447 16:31010341-31010363 AGCTTGGGGGTGGGGAGAATGGG - Intronic
1137744305 16:50809670-50809692 ACTCAGAGGGTGGGGACAATGGG - Intergenic
1139113769 16:63924209-63924231 AGCTGGGAGGTGGGGAAAATGGG + Intergenic
1139206005 16:65028920-65028942 ACCTAGGGGCAGGGGAAAATAGG + Intronic
1139513706 16:67441279-67441301 ACCCAGCAGGTGGGAACAGTAGG - Intronic
1139585597 16:67901083-67901105 GGCTGAGAGGTGGGGACAATGGG - Intronic
1141440486 16:84026578-84026600 ACCCAGGAGGTGGTGGCAGTGGG + Intronic
1142148525 16:88502624-88502646 ACCTGCGAGGTGGGGACCCTCGG - Intronic
1143731657 17:8885621-8885643 ACCCAGGAGGTGGGGCCATGGGG - Intronic
1144088390 17:11831484-11831506 ATGTTGGAGGTGGGGACAAGTGG - Intronic
1145852594 17:28115936-28115958 ATCTAGGTGGTGGGTATAATGGG - Intronic
1146688291 17:34856524-34856546 ATCCAGGGGGTGGGGAAAATGGG + Intergenic
1147327751 17:39677889-39677911 ACCATGGCGGTGGGGACAAGTGG + Intronic
1147365183 17:39954421-39954443 TCCTTGGAGGAAGGGACAATAGG - Intergenic
1150320909 17:64213710-64213732 ACTTAGAAGGAGAGGACAATGGG + Exonic
1151872203 17:76844016-76844038 ACCCTGGAGGTGGGGACATCTGG + Intergenic
1153931804 18:9885697-9885719 ACTTAGGAGCTGGTCACAATGGG + Intergenic
1157445149 18:47738860-47738882 GACTAGGAGGTGGGGACTTTGGG - Intergenic
1157491877 18:48129276-48129298 AACCAGGAGATGGGGACATTGGG - Intronic
1157733227 18:50022831-50022853 ACCTAGGAGGTGGGGGTAAAGGG - Intronic
1160925152 19:1540757-1540779 ACCTAGGAGGAGGGATCAGTGGG + Intergenic
1161736936 19:5997205-5997227 ACCATGGAGCTGGGGACAAGCGG + Exonic
1162311889 19:9913022-9913044 ACCTTGAAGGTGGAGACACTCGG + Intronic
1164024907 19:21343136-21343158 ACCTTGCCAGTGGGGACAATAGG - Intergenic
1168289241 19:55349002-55349024 CCCTGGGAGGCGGGGACAAGGGG + Intergenic
1168435036 19:56309960-56309982 ACCTAGTGAGTGGGGAGAATGGG + Intronic
925821605 2:7804665-7804687 GCGTGGGAGGTGGGGACGATTGG + Intergenic
925863850 2:8206227-8206249 ACATAGGAGATGGTGAGAATGGG + Intergenic
925875681 2:8309404-8309426 ACCTAGGAGGTGGGGAGGCCCGG + Intergenic
927812822 2:26189562-26189584 ACCTGTGATGTGGGGACATTTGG + Exonic
929928134 2:46231916-46231938 AGCTAGGAGGTGGGGTCACGTGG + Intergenic
929980003 2:46669305-46669327 ACCTAAGAGGGGAGGAAAATTGG + Intergenic
930014946 2:46963883-46963905 TCCTAGGTGCTGGGCACAATTGG - Intronic
931034208 2:58219004-58219026 AACTAGGATGTGGGCACTATGGG - Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932675224 2:73774543-73774565 ATCTATGAGGTGGGGAGAAAAGG - Intronic
933175589 2:79169348-79169370 ACCTAGGAGGCGGGGATCAGAGG + Intergenic
935353896 2:102180257-102180279 ACCCAGAAGGTGGGCAAAATTGG + Intergenic
946138445 2:217667444-217667466 AACAAGAAGGTGGGGACAAAGGG + Intronic
947747216 2:232514550-232514572 ATGTAGGAGGAGGGGAAAATGGG + Intergenic
947956604 2:234197451-234197473 ATGTTGGAGGTGGGGACTATTGG - Intergenic
948060174 2:235037274-235037296 ACCAAGCAGCTGGGGACACTGGG - Intronic
948093791 2:235317267-235317289 GGCTGGGAGGTGGGGAAAATGGG + Intergenic
948475724 2:238217859-238217881 ACCCAGGAGGTTGAGACTATAGG + Intergenic
1170540981 20:17387762-17387784 AACTGGGAGGCGGGGACAAGTGG + Intronic
1175627711 20:60502717-60502739 ACCTAGGAGGTGGCGACTGTGGG - Intergenic
1176959124 21:15139734-15139756 ACCCAGGAGGTGGTGACTACAGG - Intergenic
1178334129 21:31728923-31728945 CCTTAGGATGTGGGGACAAAAGG + Intronic
1182131816 22:27859536-27859558 ATCTAGGAGGAGGGGAGAATTGG - Intronic
1183095913 22:35552216-35552238 ACCAAGGAGCTGTGGACAAGCGG - Exonic
1183177461 22:36234790-36234812 ACCTAGGAAGTGTGTACCATTGG + Intronic
1185043418 22:48517316-48517338 ACCTGGGACCTGGGGAGAATGGG - Intronic
951066750 3:18275953-18275975 AATTAGGAGGTGGGGACCTTTGG + Intronic
952954132 3:38546093-38546115 ACGAAGGAGGTGGAGCCAATGGG + Intergenic
953507754 3:43502920-43502942 AGCTAGGTGGAGGGGATAATAGG + Intronic
954425564 3:50441105-50441127 ACCCAGGTGGTGGGGACAGGGGG + Intronic
959481617 3:106879525-106879547 AACTGGGAGGTGGGGGAAATGGG + Intergenic
961339156 3:126205525-126205547 ACCTAGGGAGTGGGTACACTTGG + Intergenic
964240067 3:154582165-154582187 AACTAGGAGTTGGGGTCATTGGG - Intergenic
965493703 3:169371348-169371370 AACTAGGAGGTAGGGGAAATGGG + Intronic
965569860 3:170161414-170161436 ACAGAGAAGGTGGGGAAAATGGG + Intronic
965618055 3:170614665-170614687 CTCTAGGAGGTGGGGATAAGTGG + Intronic
967290671 3:187916784-187916806 ATGCAGGAGGTGGGGACAATTGG - Intergenic
967507018 3:190263870-190263892 ACTTGGGAGGTGGGGAGATTGGG + Intergenic
970983838 4:22132022-22132044 ACATGGGGGGTGGGGAAAATGGG - Intergenic
971512191 4:27440586-27440608 ACCTACAAGATGGGGATAATAGG - Intergenic
972378328 4:38494883-38494905 ACCGAGGAGATAGGGACAGTGGG - Intergenic
977917215 4:102607579-102607601 CACTGGGAGGTGGGGACAAAAGG + Intronic
978954223 4:114595496-114595518 CCCGAGGGGGTTGGGACAATGGG - Intergenic
981137140 4:141223366-141223388 ACCTGGGACTCGGGGACAATTGG + Intronic
981375132 4:144006376-144006398 ACCAAGGAGGTGGGGTGACTTGG + Intronic
981461060 4:145014167-145014189 AGCTCGGAGGTGGGTACCATGGG + Intronic
982064022 4:151635720-151635742 AGCTAGGTGGTAGGGAAAATGGG + Intronic
985100539 4:186454010-186454032 TGCTAGGAGGTCGGGACATTTGG - Intronic
987061989 5:14251710-14251732 CCCTGGGAGGTGGGAACAATTGG + Intronic
988243777 5:28650631-28650653 GGCTAGGAGGTGGGGAGAATAGG - Intergenic
989460449 5:41691974-41691996 ATATTGGAGGTGGGGCCAATGGG + Intergenic
989755619 5:44949570-44949592 AGGTAGGAGGTCGGGACCATTGG - Intergenic
996144368 5:119955555-119955577 ACCAAGGAGGTGGGGAAAGCTGG + Intergenic
996500189 5:124208001-124208023 ACAGAGGAGGTGTGGACAGTTGG - Intergenic
996577540 5:124992852-124992874 GGCTAGGGGGTGGGGGCAATGGG - Intergenic
997269754 5:132526651-132526673 ACCTCTGAGGTGGGGACAGAAGG + Intergenic
1001946657 5:175784419-175784441 ACTAAGGAGGTGGCGACAAGTGG - Intergenic
1002567294 5:180119176-180119198 ACCTCTGAGGTGGGGACATGGGG + Intronic
1002708860 5:181182035-181182057 TCCTAGGAGGCGGGGATAACAGG - Intergenic
1003467211 6:6392284-6392306 ACCTAGCTGGTGGGGGCAGTGGG + Intergenic
1006735027 6:36267527-36267549 TCCAAGCAGGTGGGGACAACGGG + Intronic
1007380459 6:41487239-41487261 ACCAATGAGGTGGGGACCTTTGG + Intergenic
1012358071 6:98340869-98340891 AACTTGGAGGTGGGGGCTATTGG + Intergenic
1012975683 6:105778810-105778832 ATCTATGAAGTGGGGATAATAGG + Intergenic
1014567243 6:122964566-122964588 AATTAGGGAGTGGGGACAATGGG + Intergenic
1015720471 6:136235950-136235972 TCCAAGGAGGTGGGGACCATAGG + Intronic
1015811197 6:137163685-137163707 CCCGAGGGGGTTGGGACAATGGG + Intronic
1017714792 6:157201347-157201369 ACCTGGGATGTGGGGACCGTGGG - Exonic
1020217074 7:6201356-6201378 TCCAAGGAGGTGGCGAGAATCGG - Intronic
1021176649 7:17457735-17457757 TTCTAGGAGGTGGGGATCATTGG + Intergenic
1021436739 7:20626149-20626171 GGCTGGGAGATGGGGACAATGGG + Intronic
1022329500 7:29363926-29363948 ACTTGGGAGGTGGGGACAAGAGG + Intronic
1025934433 7:66023439-66023461 GGCTAGGAGGAGGGGAGAATGGG + Intergenic
1026744929 7:73004370-73004392 ACCTGGGAGGTGGTGACCCTGGG + Intergenic
1027031034 7:74889037-74889059 ACCTAGGAGGTGGTGACCCTGGG + Intergenic
1027098811 7:75360712-75360734 ACCTGGGAGGTGGTGACCCTGGG - Intergenic
1027548232 7:79557502-79557524 CCCTAGGAGGTGGGGAGAGTAGG + Intergenic
1029399910 7:100337515-100337537 ACCTGGGAGGTGGTGACCCTGGG - Intronic
1029716947 7:102333987-102334009 ACCTGGGAGGTGGTGACCCTGGG + Intergenic
1030895214 7:115051245-115051267 GCCAAGGAGGTGATGACAATGGG + Intergenic
1034223298 7:149461390-149461412 ACCTACGAGGTGGCGAGAACTGG + Intergenic
1034955704 7:155333172-155333194 ACCCAGAAGGTGGGAAAAATGGG + Intergenic
1036935385 8:12997175-12997197 ATGTTGGAGGTGGGGACTATTGG + Intronic
1037742122 8:21616321-21616343 AGGAAGGTGGTGGGGACAATGGG + Intergenic
1039062333 8:33581648-33581670 ACCCAGGAGGAGGGGGCATTCGG + Intergenic
1039946182 8:42130723-42130745 AGCTAGGAGGAGGGGAAAGTAGG - Intergenic
1041022012 8:53647773-53647795 ACCTAGGAGGTTGAGACAAGAGG - Intergenic
1043729162 8:83652280-83652302 GGCTAGGGGGAGGGGACAATGGG + Intergenic
1044205548 8:89488815-89488837 CACTAGGAGGTGGGGATAATTGG + Intergenic
1044947176 8:97400178-97400200 ACTTTGCAGGTGGGGACACTGGG - Intergenic
1048429443 8:134355876-134355898 ATCTAGTGGGTGGGGAAAATAGG + Intergenic
1048637694 8:136316375-136316397 AGCTGGGAGGTGGGGAAAATGGG - Intergenic
1051000064 9:12270787-12270809 ACCTGGGCAGTGGGGAAAATGGG - Intergenic
1052462667 9:28786319-28786341 ATATGGGAGGTGGGGACAAAGGG + Intergenic
1053265878 9:36713123-36713145 AGCTGGGAGGAGGGGAGAATGGG - Intergenic
1056575459 9:87853052-87853074 ACCTAAGAGGTGGGAGCAAATGG + Intergenic
1060198588 9:121638904-121638926 TCCTAGGAGGTGGGAATCATGGG + Intronic
1060309307 9:122445095-122445117 ATCTGTGAAGTGGGGACAATGGG + Intergenic
1060616717 9:125023261-125023283 ACCTTGGAGGGTGGGGCAATTGG - Intronic
1060621621 9:125072687-125072709 GGCTAGGAGGAGGGGAAAATGGG - Intronic
1060819012 9:126651047-126651069 TCCTAGGATGTGGGGACATGGGG + Intronic
1060851028 9:126876056-126876078 CCCTAGGAGGTGAGGATATTGGG + Intronic
1061649003 9:132031055-132031077 ACTGAGGAAGTGGGGACACTCGG + Intronic
1186293469 X:8123982-8124004 ACCCAGGAGATGGTGGCAATGGG - Intergenic
1186547569 X:10466587-10466609 ACCTAGGAGGAGGGTGCTATTGG - Intronic
1187032456 X:15501916-15501938 ACCCAGGAGCTGGGGACAGAGGG + Intronic
1188242020 X:27804511-27804533 GCCTTGGAGTTGGGGTCAATAGG - Intergenic
1189560086 X:42183395-42183417 ACATTGGAGGTGGGGCTAATGGG - Intergenic
1190681626 X:52831170-52831192 ACCCAGGAGCTGGGGACAGGTGG + Intergenic
1190885949 X:54531001-54531023 ACCTAAGAGGAGGGGGCAATTGG - Intronic
1190998698 X:55637154-55637176 ACCCAGGAGCTGGGGACAAGTGG + Intergenic
1195441171 X:104900097-104900119 ACCTAGCAGATGAGGAAAATGGG - Intronic
1198751056 X:139936687-139936709 AGATTGGGGGTGGGGACAATAGG - Intronic
1198792623 X:140362117-140362139 AGCTAGGGGGAGGGGATAATTGG + Intergenic