ID: 1126105450

View in Genome Browser
Species Human (GRCh38)
Location 15:45144175-45144197
Sequence GGCGTCCACGGTTGCTGGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126105450_1126105459 21 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105459 15:45144219-45144241 CCAAGGAGTATGACCTGGTATGG 0: 1
1: 1
2: 0
3: 7
4: 83
1126105450_1126105460 30 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105460 15:45144228-45144250 ATGACCTGGTATGGCTCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1126105450_1126105454 4 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105454 15:45144202-45144224 TCTGCTGCTCAAGATCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 206
1126105450_1126105455 16 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105455 15:45144214-45144236 GATCCCCAAGGAGTATGACCTGG 0: 1
1: 1
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126105450 Original CRISPR GGCGTCCACGGTTGCTGGAC AGG (reversed) Exonic