ID: 1126105450

View in Genome Browser
Species Human (GRCh38)
Location 15:45144175-45144197
Sequence GGCGTCCACGGTTGCTGGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126105450_1126105460 30 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105460 15:45144228-45144250 ATGACCTGGTATGGCTCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1126105450_1126105455 16 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105455 15:45144214-45144236 GATCCCCAAGGAGTATGACCTGG 0: 1
1: 1
2: 0
3: 5
4: 67
1126105450_1126105459 21 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105459 15:45144219-45144241 CCAAGGAGTATGACCTGGTATGG 0: 1
1: 1
2: 0
3: 7
4: 83
1126105450_1126105454 4 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105454 15:45144202-45144224 TCTGCTGCTCAAGATCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126105450 Original CRISPR GGCGTCCACGGTTGCTGGAC AGG (reversed) Exonic
900168515 1:1254744-1254766 GGCGTCCGCGGGTGCTGGTCTGG - Intronic
900227778 1:1540845-1540867 GGCGTCCAGGGTCACCGGACAGG - Intergenic
1083747816 11:64745129-64745151 GGCGTCCGCGGTTGGGGGAGGGG - Intronic
1085322384 11:75583194-75583216 GGAGTCCCCGGTGGCTGGTCTGG - Intergenic
1092973318 12:13719931-13719953 GGCTTACAAGGTAGCTGGACTGG - Intronic
1113640803 13:111955463-111955485 GGAGCCCACGGTCGCTGGGCAGG + Intergenic
1117962671 14:61178591-61178613 GGCAGCCACAGTTGCTGGAGCGG + Intergenic
1122415995 14:101549761-101549783 GGTGTCCTCGGTGGCTGGGCCGG - Intergenic
1125725685 15:41867070-41867092 GGCGCCCCCGGGTGCGGGACCGG - Exonic
1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG + Exonic
1126105450 15:45144175-45144197 GGCGTCCACGGTTGCTGGACAGG - Exonic
1128762121 15:70224237-70224259 GGTGATCACGGGTGCTGGACGGG + Intergenic
1132623321 16:878622-878644 GGCGCCCATGGTTGTTGGCCGGG - Intronic
1135416684 16:22273858-22273880 GTTGCCCATGGTTGCTGGACTGG - Intronic
1140731875 16:77863843-77863865 GGAGTCCACATTTGCTGGATTGG - Intronic
1141349671 16:83282735-83282757 GGTGTCCAGGTTTGCTGGAAAGG - Intronic
1143845420 17:9769714-9769736 TGCCTCCACGGTAGCAGGACGGG + Intergenic
1145256080 17:21323230-21323252 GGGGTCCACGGCTGCGGGAGGGG + Intergenic
1159229596 18:65588786-65588808 GGGAGCCACAGTTGCTGGACAGG - Intergenic
1163847690 19:19646667-19646689 GGAGTCCCCGGTGGCTGGAGGGG - Intronic
1165225066 19:34349020-34349042 GGCCTGCACGGTGGCTGGTCGGG + Exonic
1166310543 19:41959914-41959936 GGGGGCCATGGTTGCTGGAGGGG + Intergenic
1168358091 19:55714794-55714816 GGCGTCCACAGATGGTGGAAGGG + Intronic
926145741 2:10396307-10396329 AGCCTCCACGGTTTCTTGACTGG - Intronic
942069903 2:172306824-172306846 GGAGTCCAGGGTGGCTGGAGTGG - Intergenic
947875722 2:233467234-233467256 GCCGTCCACGCCTGCTGGATCGG + Intronic
947956638 2:234197678-234197700 GGCTTCCACGGTTGGGAGACAGG + Intergenic
948809567 2:240467700-240467722 GAGGTCCCCGGTTGCTGGTCAGG + Exonic
1174363127 20:50040815-50040837 GGCATCCCAGGTTGCAGGACTGG + Intergenic
1184597520 22:45523218-45523240 GGCGGCCAGGGTGGCTGGAGTGG + Intronic
1184663730 22:45976999-45977021 GGGGTCCACGGTCGCTCAACCGG - Exonic
950432746 3:12960383-12960405 GCCATCCACGGTGGCTGTACAGG + Intronic
953910174 3:46888853-46888875 GGCGGCCACGCTGGCTGGCCAGG + Intronic
959919939 3:111859327-111859349 GGCTTTCACGGCTGCTGGAAGGG - Exonic
961377249 3:126475392-126475414 GGCGCCCGCGGTTGCGGGGCCGG + Exonic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
1004260363 6:14102451-14102473 GGGTTCCAAGGTTGATGGACAGG + Intergenic
1019716511 7:2541823-2541845 GGCCCCCAGGCTTGCTGGACGGG - Exonic
1019729589 7:2622785-2622807 GGGGTCCACGGAGGCTGGGCTGG + Intergenic
1023996708 7:45162969-45162991 GGCCTCCAAGCCTGCTGGACTGG + Intronic
1049485614 8:142858373-142858395 GGCAGCAACGGGTGCTGGACTGG + Intronic
1056824011 9:89864366-89864388 GGCTTGCAGAGTTGCTGGACCGG + Intergenic
1056847966 9:90056828-90056850 GGTCTCCACGGATGCTGGAGTGG + Intergenic
1057125702 9:92614287-92614309 GGAGTTCACTGTTGCTGGGCTGG - Exonic
1057264160 9:93603088-93603110 GGCTTCAGCGGTTGCTGGGCTGG + Intronic
1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG + Intergenic