ID: 1126105454

View in Genome Browser
Species Human (GRCh38)
Location 15:45144202-45144224
Sequence TCTGCTGCTCAAGATCCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126105450_1126105454 4 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105454 15:45144202-45144224 TCTGCTGCTCAAGATCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 206
1126105452_1126105454 -8 Left 1126105452 15:45144187-45144209 CCGTGGACGCCGCACTCTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1126105454 15:45144202-45144224 TCTGCTGCTCAAGATCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 206
1126105451_1126105454 -1 Left 1126105451 15:45144180-45144202 CCAGCAACCGTGGACGCCGCACT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1126105454 15:45144202-45144224 TCTGCTGCTCAAGATCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 206
1126105447_1126105454 27 Left 1126105447 15:45144152-45144174 CCTCCACAGAAGGTCAACTTCGT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1126105454 15:45144202-45144224 TCTGCTGCTCAAGATCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 206
1126105448_1126105454 24 Left 1126105448 15:45144155-45144177 CCACAGAAGGTCAACTTCGTCCT 0: 1
1: 0
2: 0
3: 12
4: 84
Right 1126105454 15:45144202-45144224 TCTGCTGCTCAAGATCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126105454 Original CRISPR TCTGCTGCTCAAGATCCCCA AGG Exonic