ID: 1126105460

View in Genome Browser
Species Human (GRCh38)
Location 15:45144228-45144250
Sequence ATGACCTGGTATGGCTCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126105451_1126105460 25 Left 1126105451 15:45144180-45144202 CCAGCAACCGTGGACGCCGCACT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1126105460 15:45144228-45144250 ATGACCTGGTATGGCTCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1126105450_1126105460 30 Left 1126105450 15:45144175-45144197 CCTGTCCAGCAACCGTGGACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1126105460 15:45144228-45144250 ATGACCTGGTATGGCTCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1126105453_1126105460 9 Left 1126105453 15:45144196-45144218 CCGCACTCTGCTGCTCAAGATCC 0: 1
1: 1
2: 2
3: 16
4: 254
Right 1126105460 15:45144228-45144250 ATGACCTGGTATGGCTCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1126105452_1126105460 18 Left 1126105452 15:45144187-45144209 CCGTGGACGCCGCACTCTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1126105460 15:45144228-45144250 ATGACCTGGTATGGCTCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126105460 Original CRISPR ATGACCTGGTATGGCTCAGC TGG Exonic