ID: 1126105580

View in Genome Browser
Species Human (GRCh38)
Location 15:45144906-45144928
Sequence TAACTTGGAGGAAGAGCGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126105569_1126105580 28 Left 1126105569 15:45144855-45144877 CCTTGGCAAATGGTTGCTTTTGC 0: 1
1: 0
2: 2
3: 16
4: 184
Right 1126105580 15:45144906-45144928 TAACTTGGAGGAAGAGCGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 156
1126105576_1126105580 -6 Left 1126105576 15:45144889-45144911 CCTTAGGTGCTGCTGTTTAACTT 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1126105580 15:45144906-45144928 TAACTTGGAGGAAGAGCGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 156
1126105575_1126105580 -5 Left 1126105575 15:45144888-45144910 CCCTTAGGTGCTGCTGTTTAACT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1126105580 15:45144906-45144928 TAACTTGGAGGAAGAGCGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 156
1126105573_1126105580 -3 Left 1126105573 15:45144886-45144908 CCCCCTTAGGTGCTGCTGTTTAA 0: 1
1: 0
2: 0
3: 13
4: 101
Right 1126105580 15:45144906-45144928 TAACTTGGAGGAAGAGCGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 156
1126105574_1126105580 -4 Left 1126105574 15:45144887-45144909 CCCCTTAGGTGCTGCTGTTTAAC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1126105580 15:45144906-45144928 TAACTTGGAGGAAGAGCGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126105580 Original CRISPR TAACTTGGAGGAAGAGCGGC AGG Exonic
900965214 1:5952729-5952751 GAAGTTTGAGGAAGAGCTGCTGG - Exonic
901768541 1:11519010-11519032 TAAGTTGGAGGCAGAGCCCCTGG + Intronic
902755801 1:18548371-18548393 TAACCTGGAAGATGAGAGGCTGG - Intergenic
904358284 1:29955545-29955567 TACCTAGGAGGAGGAGGGGCTGG + Intergenic
905298361 1:36969044-36969066 TAATTTGGGGGAAGAGAGGGTGG - Intronic
905330495 1:37192069-37192091 TACCTTGGGGGAAGGGAGGCTGG - Intergenic
906388556 1:45393444-45393466 TATATTGGAAAAAGAGCGGCCGG + Intronic
907717962 1:56945260-56945282 TAATTTGGAGGTAGAGCTGATGG + Intronic
908006003 1:59730166-59730188 TTACTTGGAGGAGCAGCTGCTGG - Intronic
908381962 1:63605229-63605251 AAAGTTGGAGGAAAAGAGGCAGG + Intronic
912694319 1:111829564-111829586 TGACTTTGAGGAAGAGTGGCAGG + Intronic
912697462 1:111852225-111852247 TGACTTGGAGGAAGGTTGGCAGG + Intronic
912725739 1:112057524-112057546 AAACATGGAGGAAGAGATGCAGG - Intergenic
913085973 1:115436866-115436888 TAACTTGGAGTGAGAGAGGGAGG - Intergenic
913531962 1:119740002-119740024 TAACTTGGATGAGGAGTGACGGG - Intronic
914243951 1:145872386-145872408 GAAGCTGGAGGAAGAGCTGCGGG - Exonic
915196738 1:154195135-154195157 GAAGCTGGAGGAAGAGAGGCTGG + Intergenic
915354561 1:155248248-155248270 CAACTTGGGGGAAGGGCAGCGGG + Exonic
915822097 1:159035004-159035026 AAACTTGGAGGAAAAGCAGAAGG + Intronic
918626775 1:186664564-186664586 TAACATGGCAGAAGAGCGGAAGG + Intergenic
921033792 1:211357069-211357091 TAGCTGGAAGGAAGAGCAGCTGG - Intronic
922500162 1:226091370-226091392 TGGGTTGGAGGAAGAGCTGCAGG - Intergenic
923046800 1:230361761-230361783 TGACTGGGAGTAAGAGCAGCAGG + Intronic
1063305111 10:4891246-4891268 GAACTTGGGGAAAGAGAGGCAGG - Intergenic
1064237376 10:13588118-13588140 AAACATGGAGGAAGGGCCGCCGG + Intronic
1065113267 10:22460448-22460470 AATCTGGGAGGAAGAACGGCTGG + Intergenic
1065125136 10:22566703-22566725 TTAGTCAGAGGAAGAGCGGCAGG - Intronic
1065655931 10:27949812-27949834 TAACTTGGAGTAGGAGGGGAGGG + Intronic
1065893285 10:30139023-30139045 TAAGCAGGAGGGAGAGCGGCCGG + Intergenic
1066040092 10:31540612-31540634 TAAGGTGGAGGTAGAGGGGCTGG - Intergenic
1067107956 10:43378029-43378051 GAGCTTGAAAGAAGAGCGGCAGG - Intergenic
1068504197 10:57878416-57878438 TAACTTGGAGGAATAACTGAGGG - Intergenic
1070830864 10:79417377-79417399 GAACTTGGAGGAAGCCAGGCAGG + Intronic
1072539704 10:96389163-96389185 TTTATTGGAGGAAGATCGGCTGG - Intronic
1075717406 10:124565000-124565022 GGACTTGGAGGAAGAGTGGGAGG + Intronic
1077539138 11:3138459-3138481 TCACTTGGAGGCAGTGCAGCTGG + Intronic
1079021985 11:16916812-16916834 TAAGTTGGAGGAAGGTGGGCAGG - Intronic
1085800196 11:79582281-79582303 TAACTTGGAGGGGGAGGGGGAGG + Intergenic
1085896867 11:80650039-80650061 AAACGTGGGGGAAGAGCAGCAGG + Intergenic
1087105935 11:94406883-94406905 GAACTTGGGGGAAGAGTGGGGGG - Intergenic
1090163808 11:124524153-124524175 GAAGTTGGAGGAAGATCGGAAGG - Intergenic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1103553419 12:121751663-121751685 TGACTTGGAGGAAGGGAGGGAGG - Intronic
1104619259 12:130298503-130298525 TAACTTGGTGGGAGTGTGGCCGG - Intergenic
1105706724 13:22971776-22971798 TATCCTGGAGGAAGAGCCCCAGG - Intergenic
1112761593 13:102698654-102698676 GATCTTGGAGGATGAGGGGCTGG - Intergenic
1117435763 14:55713959-55713981 TCACTTAGAGGCAGAGGGGCAGG + Intergenic
1117836776 14:59815991-59816013 TATCTTGGACGAAGAGCAGGTGG - Intronic
1118825474 14:69376402-69376424 TATCTTGGAGGAAAGGAGGCTGG - Intergenic
1120826133 14:88957230-88957252 TAACTATGAGGAAGACTGGCAGG + Intergenic
1125972599 15:43923938-43923960 AAAGTTGGAGGCAGAGCAGCTGG - Intronic
1126105580 15:45144906-45144928 TAACTTGGAGGAAGAGCGGCAGG + Exonic
1129690883 15:77712654-77712676 TCACATGGAGGAAGGGAGGCAGG - Intronic
1132520193 16:383753-383775 GACCTTGGAGGAGGAGAGGCGGG + Intronic
1136395094 16:29988177-29988199 TAACTTAGGGGAGGAGCGCCAGG - Exonic
1137556521 16:49473811-49473833 CACCTTGGAGGCAGAGTGGCTGG - Intergenic
1138622574 16:58223669-58223691 TGACTTGGAGGACCAGCGCCTGG - Intergenic
1141552059 16:84812877-84812899 TGGCTTGGAGGAAGAGCTCCTGG - Intergenic
1142107541 16:88313118-88313140 GAACTTGGAGGCACAGCGGAGGG - Intergenic
1146280333 17:31540476-31540498 AGACTTGGAGGAGGAGAGGCTGG + Intergenic
1147970328 17:44215986-44216008 TCACCTGGAGGAAGAGGGGTGGG + Exonic
1156893975 18:42222989-42223011 TGCCTTGGAGGAAGAGCTGCTGG - Intergenic
1162117772 19:8441984-8442006 TAGCCTGTAGGAAGAGCAGCAGG + Intronic
1162550747 19:11357073-11357095 GAACTGGGAGGCAGACCGGCTGG + Intronic
1163502720 19:17686348-17686370 CAACTTGGAGGATGTGAGGCGGG + Intronic
1163591933 19:18198764-18198786 TGACATGGAGGATGAGCGGGTGG - Exonic
1164557272 19:29263318-29263340 CAACTGGGATGAAGAGCAGCTGG + Intergenic
1166544578 19:43626402-43626424 TAGCTTGGAGGACAAGAGGCGGG - Intronic
1168071922 19:53958316-53958338 CCACTTGGAGGAGGAGCGGTGGG + Intergenic
926426415 2:12742604-12742626 TACCTTGGAGGAGGAGAGGTTGG + Exonic
927497851 2:23562689-23562711 TAACTTGTAGGAAGACAAGCAGG + Intronic
930610797 2:53540793-53540815 TAAGTTGGAGCAAGAGAGCCAGG + Intronic
932860291 2:75284654-75284676 TATCCTGGAGCAAGAGCCGCTGG + Intergenic
936089858 2:109494561-109494583 TACTTTGGAGGAGGAGCTGCTGG + Intronic
940010149 2:149044589-149044611 TAAGTTGGAGGAAGAGAAGGAGG - Intronic
940298035 2:152149935-152149957 TGAGTTGGAGGAAGAGGGGTTGG + Intronic
941750399 2:169129720-169129742 TAACTTGCAGGTAGAAGGGCAGG + Intronic
941808247 2:169731543-169731565 TAACTTGGAGTAAGGGCTTCTGG - Intronic
943537328 2:189168817-189168839 TAACTTGGAAGGAGAGATGCAGG - Intronic
945177741 2:207060576-207060598 ATACTTGGTGGAAGAGAGGCTGG - Intergenic
946523516 2:220492906-220492928 TGACTTGGAGTAAGAGCTTCAGG + Intergenic
948101465 2:235377406-235377428 AAACTTTGAGGAAAAGGGGCAGG - Intergenic
1169484971 20:6021844-6021866 TAACTTGGAGGAAAACTGGATGG - Intronic
1172428407 20:34871843-34871865 TGGCTAGGAGGAAGAGCAGCAGG + Intronic
1173110523 20:40183505-40183527 TGACTTGGAGGCAGAACGGGGGG + Intergenic
1174550666 20:51359259-51359281 CAACTGGCAGGAAGAGCGGAGGG - Intergenic
1177228556 21:18288830-18288852 TAAAAAAGAGGAAGAGCGGCCGG - Intronic
1177894295 21:26843003-26843025 AATCTTGGAGCAAGAGCGGCAGG + Intronic
1178361021 21:31948582-31948604 GAACTTGGAGGAAGGGAGGGAGG + Intronic
1180150261 21:45943715-45943737 TCACCTGGAGGAAGAACAGCAGG + Intergenic
1180675856 22:17586086-17586108 TATCTTGGAGGACGAGCAGGAGG + Intronic
1181467121 22:23116271-23116293 TAACTTGGAGGTGGAGCTGCGGG + Intronic
1181724657 22:24803594-24803616 TATCTTGGAGGAAAAGCTCCAGG + Intergenic
1181887153 22:26030483-26030505 TAACTTGGAGACAGAGAGACTGG + Exonic
1183988889 22:41584866-41584888 AATCTTGGAGGATGAGTGGCAGG - Intronic
1184905786 22:47485582-47485604 TGACCTGGAGGAAGAGCGACTGG + Intronic
1184937670 22:47736844-47736866 AAACTTCGAGCAAGAGCGTCAGG + Intergenic
1185199387 22:49492225-49492247 AAAGATGGAGGAAGAGCAGCTGG - Intronic
949931560 3:9082665-9082687 GAACTGGGAGGAAGAGCAGGAGG - Intronic
954406147 3:50346005-50346027 TAAGGAGGAGGAAGAGCAGCGGG - Exonic
954625029 3:52017799-52017821 TGACTTGGAGGAGCAGAGGCTGG - Intergenic
959358076 3:105357257-105357279 TACCATGGAGGAAGAGATGCTGG + Intergenic
959675992 3:109036801-109036823 AAATTTGGAGCAAGAGCAGCTGG - Intronic
961586224 3:127928336-127928358 TAACTAGGAGGAAGAGAAGCTGG + Intronic
961996360 3:131248517-131248539 TAACTTGGAGAAAGGCTGGCAGG - Intronic
963754841 3:149224201-149224223 TAAATAGGAGGGAGAGGGGCCGG + Intergenic
964727271 3:159826481-159826503 TAACTGTGAGGAAGAGCAACTGG - Intronic
964762425 3:160146854-160146876 TATCTTGGAGGAAGAGAAGGTGG - Intergenic
968372964 4:12017-12039 ACACTTGGAGCAAGAGTGGCCGG - Intergenic
969631700 4:8342860-8342882 AAGCATGGAGGAGGAGCGGCTGG + Intergenic
971490746 4:27209712-27209734 CAACTTGGAGGAAGCTCAGCTGG - Intergenic
972133523 4:35864117-35864139 TAGCCTCGAGGAAGAGAGGCCGG + Intergenic
973820972 4:54660998-54661020 TAGCTTGGAGGAAGGGCTGTAGG + Intronic
983422702 4:167540129-167540151 GAACTTGGGGGAAGAGTGGGGGG + Intergenic
985135626 4:186783171-186783193 TAACTTGGAGGAATAGGGCCAGG - Intergenic
985462431 4:190120550-190120572 ACACTTGGAGCAAGAGTGGCCGG + Intergenic
986995544 5:13602977-13602999 CAACTTAGAGGAAGGGAGGCAGG + Intergenic
988129892 5:27090569-27090591 TAACATGAAGGAAGAGAGGGTGG - Intronic
988370881 5:30365598-30365620 GAGCTTGGAGCACGAGCGGCTGG + Intergenic
988734405 5:34006620-34006642 TAATTAGGAGGAAGGTCGGCTGG - Intronic
991337046 5:65560359-65560381 TACTTTGGAGGAAGAGTGGAAGG + Intronic
996081998 5:119267553-119267575 TAACTTTGGGGAAGGGCGTCAGG - Intergenic
999658183 5:153830897-153830919 TAACTTGGACTTAGAGAGGCTGG - Intergenic
1002771282 6:292458-292480 TTACAGGGAGGAGGAGCGGCGGG - Exonic
1002936107 6:1674158-1674180 TGACTAGGAGGAGGAGCAGCAGG - Intronic
1005896617 6:30184709-30184731 AAACTTGGATGAACAGGGGCTGG + Exonic
1006394771 6:33780150-33780172 AAACTTGGCGGAGGAGCTGCTGG + Exonic
1010662034 6:78582804-78582826 TTACTAGGAGGAAGAGAGCCAGG - Intergenic
1011571171 6:88737461-88737483 TAAATTGGGGGAAGGGAGGCAGG + Intronic
1016684987 6:146871006-146871028 TGACTTGGAGGAGCAGGGGCCGG + Intergenic
1021906873 7:25343301-25343323 TGCCTTGGAGGAAGAGGGGAGGG + Intergenic
1023497257 7:40811044-40811066 TAACTTTGAGGAAGATCAGATGG + Intronic
1024169792 7:46772961-46772983 CTACTTGGGGGAAGAGGGGCCGG - Intergenic
1028962677 7:96767141-96767163 TAACTGGGAGGATGAAAGGCAGG + Intergenic
1029064472 7:97835450-97835472 TAACTGGGAAGAAGAGCCCCTGG + Intergenic
1029412629 7:100425276-100425298 TACCTTAGATGAAGAGGGGCAGG + Intronic
1037340919 8:17844077-17844099 GAAATTGGAGGAAGAGGGGGTGG + Intergenic
1037835212 8:22211549-22211571 TAAGGTGGAGGAAGAGGGGCTGG - Intronic
1037899886 8:22681765-22681787 TAACATGGAGGCAGAGTGGCTGG - Intergenic
1039892203 8:41693342-41693364 TTGCTAGGAGGAAGAGCAGCGGG - Intronic
1041952269 8:63516900-63516922 GAACTTGGAGGATGAGAGTCGGG + Intergenic
1042883738 8:73524200-73524222 TAATTTAGAGGAAGAGATGCTGG + Intronic
1046466844 8:114615844-114615866 TCACATGGAGGAAGAGCTGAAGG + Intergenic
1049014525 8:139910197-139910219 GCAGCTGGAGGAAGAGCGGCGGG - Exonic
1049101147 8:140579969-140579991 GAACAAGGAGGAAGAGGGGCAGG + Intronic
1049282740 8:141758747-141758769 TAAATTGGAGGAGGAGGTGCAGG - Intergenic
1050563793 9:6861647-6861669 TCACTGGGAGGAAGAGAGGAGGG - Intronic
1050737904 9:8785540-8785562 TAATATGGAGGCAGAGGGGCTGG - Intronic
1051079197 9:13277069-13277091 TAACTGTGAGGAATAGAGGCTGG - Intronic
1055303087 9:74902516-74902538 CAACTTGCAGGAAGAGAGGTAGG - Intergenic
1056561214 9:87731486-87731508 TCACTAGGAGGAAGAGTGGGTGG + Intergenic
1056577316 9:87866388-87866410 TCACTAGGAGGAAGAGTGGGTGG + Intergenic
1057446821 9:95122178-95122200 TTACCTGGAGGGAGAGAGGCAGG + Intronic
1058540172 9:106003464-106003486 GAACTTGGGGTAAGAGTGGCGGG - Intergenic
1058884087 9:109309987-109310009 TACCTGGGAGGAAGAGTGGGCGG - Intronic
1059774058 9:117457349-117457371 TTACCTGGAGGAAAAGCTGCTGG + Intergenic
1060221816 9:121768149-121768171 AAACTTGGAGGAAAAGCCGAAGG + Intronic
1060652477 9:125340430-125340452 TAACTTTGAGGAAGAGGGGGAGG + Intronic
1062684422 9:137802951-137802973 TACCTTGGAGGAAGAGAGGAGGG + Intronic
1186053060 X:5620656-5620678 TAACTGGGAGGAAAAGCTGCTGG + Intergenic
1186428623 X:9485466-9485488 TAACTTGGAGTAGGTGAGGCAGG + Intronic
1189254991 X:39630980-39631002 AATCTTGGAGGCAGAGCTGCAGG + Intergenic
1189853028 X:45195736-45195758 AAACTTGTAAGAAGAGCAGCAGG - Intronic
1192793224 X:74405151-74405173 TAAGAAGGAGGCAGAGCGGCTGG + Intergenic
1197719953 X:129738505-129738527 CAGCTTGGAGGAAGAGAGGGAGG + Intergenic
1198422427 X:136481112-136481134 TAATTTGGAGGAACAGTGGTAGG + Intergenic
1199367429 X:147003326-147003348 TAACTTGAAGCAGGAGCTGCTGG - Intergenic
1201764111 Y:17563649-17563671 TGCCCTGGAGGAAAAGCGGCTGG - Intergenic
1201837442 Y:18342341-18342363 TGCCCTGGAGGAAAAGCGGCTGG + Intergenic