ID: 1126109034

View in Genome Browser
Species Human (GRCh38)
Location 15:45165072-45165094
Sequence GACCAGGATGTGTCTCAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126109027_1126109034 3 Left 1126109027 15:45165046-45165068 CCATGTGTGGGCTCAGGGACCCC 0: 1
1: 0
2: 2
3: 33
4: 286
Right 1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 173
1126109021_1126109034 24 Left 1126109021 15:45165025-45165047 CCAGGTGGCCATAGTCAGTCACC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 173
1126109022_1126109034 16 Left 1126109022 15:45165033-45165055 CCATAGTCAGTCACCATGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 93
Right 1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126109034 Original CRISPR GACCAGGATGTGTCTCAGCC TGG Exonic
900432581 1:2609905-2609927 GACCAGGCTGTGTCTTGGACCGG - Intronic
903877625 1:26486337-26486359 GACTAGGTTGTGTCTCATCCTGG - Intergenic
904906169 1:33898952-33898974 GACCAGGAAGAGTCACAGGCAGG - Intronic
912132457 1:106619644-106619666 GCCCAGGAGCTGTCACAGCCCGG + Intergenic
912542236 1:110425803-110425825 CACCAGGATGGGGCTGAGCCTGG - Intergenic
913674472 1:121128242-121128264 GAACAGGTTGTGTCTCCACCTGG - Intergenic
914251426 1:145924989-145925011 GAAAAGGATGTGGCTCAGGCTGG - Intergenic
915161460 1:153923220-153923242 GACCCGGATGTGTCTGGGACTGG - Intergenic
916301375 1:163278197-163278219 GACCATAATGTGCCTCAGACAGG - Intronic
918267260 1:182855611-182855633 TGCCAGTATGTTTCTCAGCCAGG - Intronic
922231219 1:223688474-223688496 AAGCAGGATGTTGCTCAGCCTGG + Intergenic
922743572 1:228030533-228030555 AACCAGGATGTGTCCTCGCCGGG + Intronic
923519755 1:234726368-234726390 GACGGGGATGTGGCTCAACCAGG - Intergenic
1067406662 10:46030181-46030203 GAGCAGGAGGTGTCCGAGCCGGG + Intronic
1069675022 10:70240295-70240317 GTCTAGGAAGTGTCTCTGCCCGG - Intergenic
1069877839 10:71574059-71574081 GGCCAGGGTGCATCTCAGCCTGG - Intronic
1070960872 10:80499419-80499441 GACCACGCTGTGTCCCAACCAGG - Intronic
1073529329 10:104216874-104216896 TTCCAGAATGTGCCTCAGCCTGG - Intronic
1074492947 10:113955319-113955341 GACCATGATGTGTCTGGTCCAGG - Intergenic
1076004271 10:126935515-126935537 CTCAAGGATGTGGCTCAGCCTGG - Intronic
1076749769 10:132536997-132537019 GGCCAGGCTGGGTCTCAGCGCGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1080970185 11:37264807-37264829 GACCAGCCTATTTCTCAGCCAGG - Intergenic
1082659596 11:55894402-55894424 GACAAAGATGTGTCTCAGGGGGG - Intergenic
1083271333 11:61574335-61574357 GAGCAGCAAGTGTCTCTGCCAGG + Intronic
1083854517 11:65386212-65386234 GTCCAGGATGAGTCTGGGCCAGG + Intergenic
1084225789 11:67714024-67714046 GCCCTGTATGTGTCCCAGCCCGG + Intergenic
1084809797 11:71605240-71605262 GCCCTGTATGTGTCCCAGCCCGG - Intergenic
1085049593 11:73373349-73373371 GGCCAGGATAGGGCTCAGCCTGG - Intergenic
1102119303 12:110428674-110428696 GACCATGATTTGTCCCAGCCTGG - Intergenic
1103886920 12:124209233-124209255 ACCCAGGATGTGTCTCAGCCAGG + Intronic
1117889134 14:60399153-60399175 GAAAAGGATGTGGCTCAGGCTGG + Intronic
1118001191 14:61525459-61525481 GACAGGGATGTGACTCATCCTGG - Intronic
1118903942 14:70010008-70010030 CACCACGCTCTGTCTCAGCCGGG + Intronic
1118999748 14:70871445-70871467 GACAAGAATGTGTCTCAGTGGGG + Intergenic
1119471765 14:74904876-74904898 GACAAGGCTGTGTTTAAGCCTGG - Exonic
1122338487 14:101008997-101009019 GCCCAGGAACTGACTCAGCCAGG - Intergenic
1122933657 14:104946128-104946150 GACGTGGAGGTGTCTCAGCCCGG - Exonic
1123019610 14:105391539-105391561 GACCAGGATGTGGCCAGGCCAGG - Intronic
1123662457 15:22576141-22576163 GACCAGGCTGAATCTCAGGCAGG + Intergenic
1124261832 15:28199763-28199785 GACCAGGCTGAATCTCAGGCAGG - Intronic
1124316257 15:28670425-28670447 GACCAGGCTGAATCTCAGGCAGG + Intergenic
1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG + Exonic
1126763897 15:51994327-51994349 GCCCAGCATCTGCCTCAGCCCGG - Intronic
1127298131 15:57627767-57627789 GACCAGGATTTTTCTAATCCTGG - Intronic
1128043309 15:64594729-64594751 GAAAAGAATGTGTCTCGGCCGGG + Intronic
1128447482 15:67776797-67776819 GGTCAGGATGTGACTTAGCCGGG + Intronic
1129032928 15:72631243-72631265 TGCCAGCATGTGTGTCAGCCAGG - Intergenic
1129204667 15:74029837-74029859 TCCCAGGATCTGTCTCTGCCAGG - Intronic
1129216949 15:74105985-74106007 TTCCAGCATGTGTGTCAGCCAGG + Intronic
1129407722 15:75330090-75330112 TTCCAGCATGTGTGTCAGCCAGG - Intergenic
1129470894 15:75752871-75752893 TGCCAGCATGTGTGTCAGCCAGG - Intergenic
1129734109 15:77950301-77950323 TGCCAGCATGTGTGTCAGCCAGG + Intergenic
1129841472 15:78745691-78745713 TGCCAGCATGTGTGTCAGCCAGG - Intergenic
1132562200 16:601037-601059 GACCAGGAGGTGGCTCTGCAAGG - Intronic
1133467826 16:6044791-6044813 GACCAGGCTGTGTCCCAGACAGG - Intronic
1133603779 16:7366171-7366193 GACCAGGATGATTTTAAGCCAGG + Intronic
1134226009 16:12390675-12390697 GCCCAGAATGTTTCTCTGCCAGG + Intronic
1134350973 16:13437528-13437550 GGCCAGGCTGGGTCTCATCCGGG - Intergenic
1135181979 16:20283038-20283060 GAAAAGAATGTGTGTCAGCCAGG + Intergenic
1137322369 16:47398068-47398090 GGACATGATGTGTCTCATCCAGG - Intronic
1138098654 16:54233710-54233732 GACCGGTATGTGCCACAGCCTGG - Intergenic
1138456138 16:57121864-57121886 GGCCAGGATGTGGCAGAGCCGGG - Intronic
1143032044 17:3973275-3973297 GAGCTGGATGTGTCTCAGTGTGG - Intergenic
1143032087 17:3973486-3973508 GAGCTGGATGTGTCTCAGTGTGG - Intergenic
1146468025 17:33102432-33102454 CACCAGGATGTGTCTTGGTCTGG + Intronic
1149865811 17:60150374-60150396 GATAAGGATGCGTCTCAGGCCGG + Intronic
1150424094 17:65063352-65063374 TACCAGGATCTGTCTGAGCTGGG - Intergenic
1152598999 17:81252179-81252201 GACCACGGTGGGTGTCAGCCTGG - Exonic
1154197957 18:12279909-12279931 GACCAGGATGTGCCCCATGCAGG + Intergenic
1157174923 18:45442895-45442917 GCCCAGGATGTGTCTGTGCATGG + Intronic
1157425408 18:47580442-47580464 GATCAGTAAGTGTCTGAGCCAGG + Intergenic
1157470535 18:47984696-47984718 GGCCAGGAAGGGGCTCAGCCAGG - Intergenic
1158264273 18:55642902-55642924 GCCCAGGATGTGGCTCACACTGG - Intronic
1160951005 19:1667440-1667462 GCCCAGGATGTCCCTCGGCCGGG + Intergenic
1161170875 19:2811963-2811985 GACCAGCAGGTGCCTCGGCCGGG - Intronic
1162433431 19:10642951-10642973 CAACAGGATGTCTCTCAGCTCGG - Intronic
1163214193 19:15863777-15863799 GACCTGGAAGTATCTCTGCCCGG - Intergenic
1163838525 19:19591529-19591551 GAACAAGAAGTTTCTCAGCCAGG - Intronic
1166475933 19:43124686-43124708 GTTCAGGAAGTGTCTCAGACTGG - Intronic
1167615572 19:50531093-50531115 GACCAGGAAGTGGCACAGCCAGG + Intronic
925048120 2:789901-789923 GCCCAGGCACTGTCTCAGCCTGG + Intergenic
927935212 2:27072233-27072255 GACCAGGTTCTGTCTTAGCCGGG + Intergenic
929948972 2:46391758-46391780 TACCAGGTTGTGGTTCAGCCAGG + Intergenic
933691070 2:85180038-85180060 GCCCAGGACGTGGCTTAGCCGGG + Intronic
933902603 2:86860818-86860840 AGCCGGGGTGTGTCTCAGCCAGG - Intronic
935777944 2:106488450-106488472 AGCCGGGGTGTGTCTCAGCCAGG + Intergenic
937871112 2:126786994-126787016 GGCCTGGAAGTGGCTCAGCCAGG + Intergenic
938240315 2:129738138-129738160 GCCCAGGAGGTGTCTGAGGCTGG - Intergenic
938622734 2:133073477-133073499 GCCCAGAATGTGTGCCAGCCTGG - Intronic
942450798 2:176107032-176107054 GACCAGGCTGCGCCTCAGGCCGG - Intronic
946781434 2:223195798-223195820 AACCAGGAGGTGGCACAGCCAGG + Intronic
1170621015 20:17996030-17996052 GACCTGGATGTGTCTCTGCTGGG + Intronic
1172271431 20:33657725-33657747 GACCAGGACTTGTCTCCTCCTGG - Exonic
1173313861 20:41925638-41925660 GAGTAGGAAGTGTCTCTGCCAGG + Intergenic
1173352679 20:42259683-42259705 GACCAGGATGTGGCTGAGGTAGG + Intronic
1173445796 20:43116966-43116988 GACCAGGGTGTGGCTTAGCTGGG + Intronic
1173951857 20:46999704-46999726 GAACAGAATTTGGCTCAGCCAGG + Intronic
1174072102 20:47906359-47906381 CAACAGGATGTGTCTTAGCGTGG + Intergenic
1174546718 20:51331300-51331322 GATCAGGATGTGGCAGAGCCAGG + Intergenic
1175802666 20:61810104-61810126 GACCTGGACGGGCCTCAGCCGGG + Intronic
1181343105 22:22198600-22198622 GAGCAGGATGTGCCTCAGCTGGG - Intergenic
1181541157 22:23574000-23574022 CACCAGGCTGTGCCCCAGCCTGG + Intronic
1181560552 22:23697237-23697259 GACCTGGATGTGAGTGAGCCTGG + Exonic
1181797220 22:25319328-25319350 GGCCAGGCTGGGTCACAGCCTGG + Intergenic
1181797221 22:25319330-25319352 CACCAGGCTGTGACCCAGCCTGG - Intergenic
1182260211 22:29068734-29068756 GACAAGGAGGTGGCTCAACCTGG + Intergenic
1183749927 22:39714056-39714078 GACCAGGCTGAGTCTGGGCCTGG + Intergenic
1185290730 22:50025892-50025914 GACCAGGATGTGGGGCAACCAGG + Intronic
950901096 3:16498382-16498404 TGCCAGGATGTGTTTCAGGCAGG + Intronic
954222712 3:49164369-49164391 CACCAGGAAGTGTCTCACTCTGG - Intronic
954610997 3:51944498-51944520 GACCACTTTGTGTCTCACCCGGG + Exonic
956870536 3:73412913-73412935 GACCCCCATGTGTCTCACCCTGG - Intronic
959117526 3:102195602-102195624 AACCAGGACGTGACTCAGCATGG - Intronic
961643106 3:128377334-128377356 GACCAAGCTCTGTCTGAGCCCGG - Intronic
961805536 3:129486844-129486866 GCCTAGGATGTGGCTGAGCCTGG + Intronic
968596629 4:1489391-1489413 GTCCAGGCTGTGTCTCTGCTTGG + Intergenic
969022128 4:4145787-4145809 GCCCTGTATGTGTCCCAGCCCGG + Intergenic
969692732 4:8713019-8713041 GACCAGGATTTGTATCAGTGTGG - Intergenic
969731738 4:8961605-8961627 GCCCTGTATGTGTCCCAGCCCGG - Intergenic
969791334 4:9495712-9495734 GCCCTGTATGTGTCCCAGCCCGG - Intergenic
972520944 4:39856015-39856037 GACCCTGATGTGTCTCAGTGTGG - Intronic
973272660 4:48277537-48277559 GACTATGATGTGTCTCAGTGTGG - Intergenic
982324482 4:154115414-154115436 GACGGGGCTGTGTCTCAGGCTGG + Intergenic
985261367 4:188118086-188118108 CACCAGGGTGTGTCGCATCCTGG - Intergenic
985606694 5:861776-861798 GACATGGCCGTGTCTCAGCCTGG - Intronic
985795823 5:1961605-1961627 GACCAGGACGTGGCTCCACCTGG - Intergenic
985827169 5:2201130-2201152 TACCAGGTTGAGTCCCAGCCTGG + Intergenic
989181795 5:38585607-38585629 AAACAGGATGTGTGTCAACCTGG + Intronic
990147189 5:52775737-52775759 GACCAGGATGAGTCAAAGTCAGG - Intergenic
993367884 5:87055280-87055302 GACCAGGATATTTCTCTGTCAGG + Intergenic
993803681 5:92376365-92376387 TACAAGTATGTGTCACAGCCAGG + Intergenic
996582196 5:125043970-125043992 GCCCAGAATGTGTCTCCTCCCGG + Intergenic
998213656 5:140220821-140220843 GACCATGAGGTGTCTCTGGCTGG + Intronic
998425909 5:142028539-142028561 GGACAGGATGTTTCTGAGCCTGG + Intergenic
998772010 5:145556515-145556537 GACCAGAATGTGCCTGAGGCAGG - Intronic
1002400919 5:178991247-178991269 GACCAGGCTGCTTCTGAGCCTGG + Intronic
1005301961 6:24479925-24479947 CACCAGGATGCGTATCAGGCTGG - Exonic
1005835286 6:29704133-29704155 GATGAGGATGTCTCACAGCCAGG - Intergenic
1006063077 6:31440335-31440357 GATGAGGATGTCTCACAGCCAGG + Intergenic
1006788373 6:36682917-36682939 TGGCAGGATGTGGCTCAGCCTGG + Intronic
1007938815 6:45757712-45757734 CCCCAGGATGTTTATCAGCCAGG + Intergenic
1007951356 6:45875344-45875366 GACCAGGGTGTGTGAAAGCCTGG - Intergenic
1008140320 6:47824342-47824364 GATCAGGCTGTGTCTCTGACTGG + Exonic
1011064564 6:83311246-83311268 GACCAGTATTTGTATTAGCCAGG + Intronic
1015522760 6:134147834-134147856 TTCCAGGATGTGTCCCAGGCTGG + Intergenic
1017681642 6:156870321-156870343 CACCAGGATGGGCCTCAGACGGG - Intronic
1019750224 7:2724560-2724582 GGCCAGGCTGTGTGTCGGCCCGG + Intronic
1020309552 7:6857829-6857851 GCCCTGTATGTGTCCCAGCCCGG + Intergenic
1023235853 7:38085891-38085913 GGCCAGAATGTGTGTCAACCTGG - Intergenic
1023718978 7:43073385-43073407 GACAAAAATGTGTCTCAGCGGGG + Intergenic
1023862773 7:44225924-44225946 GACCGGGAGGTGGCCCAGCCTGG + Intronic
1025837282 7:65106055-65106077 GCCCATGAACTGTCTCAGCCAGG - Intergenic
1025907062 7:65795581-65795603 GCCCATGAACTGTCTCAGCCAGG - Intergenic
1031835013 7:126671929-126671951 GACAAAAATGTGTCTCAGCGGGG - Intronic
1032551357 7:132787214-132787236 TAGCAGGACATGTCTCAGCCTGG - Intronic
1034880327 7:154757888-154757910 GACCAGGAAGTGGCTCAGGGAGG + Intronic
1035676335 8:1458931-1458953 GACCAGTGTGTGTCCCAGACAGG + Intergenic
1035676349 8:1459003-1459025 GACCAGCATGCGTCCCAGACAGG + Intergenic
1039283765 8:36016463-36016485 GACCAGCATTTGTCTCAGGGAGG + Intergenic
1041532540 8:58886423-58886445 GCCCTGGTTGTGTCTCAGCAAGG - Intronic
1043316618 8:78930419-78930441 GATCAGGATATTTCTCAGCAGGG + Intergenic
1048439779 8:134451302-134451324 GAGCAGGTTGCGTCTCAGCTGGG + Intergenic
1048519146 8:135137871-135137893 GATATGGATGAGTCTCAGCCAGG + Intergenic
1049022822 8:139969484-139969506 TGCTAGGATGTGTCTGAGCCAGG - Intronic
1053597960 9:39583034-39583056 GAGCAGGGTGTGTCTCAATCTGG + Intergenic
1053855983 9:42340043-42340065 GAGCAGGGTGTGTCTCAATCTGG + Intergenic
1056179299 9:84066166-84066188 GAACATGAGATGTCTCAGCCAGG + Intergenic
1056926660 9:90840169-90840191 GCCCAGGCGGTGTCCCAGCCAGG - Intronic
1061043563 9:128152794-128152816 GTCCAGGCAGTCTCTCAGCCTGG - Intronic
1061169042 9:128941423-128941445 GACCTGCTTGTGTCTCTGCCAGG + Exonic
1061866094 9:133492469-133492491 GGCCAGGACGGGTCTCGGCCTGG - Intergenic
1062015060 9:134287226-134287248 GACCAGGCTGTGGTTCAGGCTGG + Intergenic
1062181132 9:135191857-135191879 GGCCAGGATGGGACCCAGCCTGG + Intergenic
1187012052 X:15289569-15289591 GACCATGAGGTGCCTCAGCTCGG - Exonic
1187719367 X:22135357-22135379 GAACAGGATGTGTCTTGCCCTGG + Intronic
1187850853 X:23590360-23590382 GACCAGATTTTCTCTCAGCCTGG - Intergenic
1189453130 X:41158283-41158305 GACTATAATGTGTCTCAGTCTGG - Intronic
1191680613 X:63836333-63836355 GACCACGTTTTGTCTCATCCAGG - Intergenic
1195216925 X:102712258-102712280 GGCCAGGATGAGCCCCAGCCTGG - Exonic
1196900787 X:120380841-120380863 ATCCAGGATGTGGATCAGCCAGG + Exonic
1197722790 X:129756265-129756287 GACCAGGGCCTGGCTCAGCCAGG + Intronic
1199007634 X:142720936-142720958 GACAATGTTGTGTCTCTGCCAGG - Intergenic