ID: 1126109419

View in Genome Browser
Species Human (GRCh38)
Location 15:45166958-45166980
Sequence CGGAAGCCGCGCGCCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126109419_1126109425 2 Left 1126109419 15:45166958-45166980 CCTCCGCCGGCGCGCGGCTTCCG No data
Right 1126109425 15:45166983-45167005 TGGCAGGCCGCCCCGCTCCCCGG No data
1126109419_1126109426 7 Left 1126109419 15:45166958-45166980 CCTCCGCCGGCGCGCGGCTTCCG No data
Right 1126109426 15:45166988-45167010 GGCCGCCCCGCTCCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126109419 Original CRISPR CGGAAGCCGCGCGCCGGCGG AGG (reversed) Intergenic
No off target data available for this crispr