ID: 1126111277

View in Genome Browser
Species Human (GRCh38)
Location 15:45176187-45176209
Sequence TTGTCGAAGGGAAAGTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126111277_1126111281 22 Left 1126111277 15:45176187-45176209 CCTTGAAACTTTCCCTTCGACAA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1126111281 15:45176232-45176254 CCTTTCACTTTGACATTCCATGG 0: 1
1: 0
2: 3
3: 26
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126111277 Original CRISPR TTGTCGAAGGGAAAGTTTCA AGG (reversed) Intronic
906546367 1:46622018-46622040 TTGTAAAAGGGAAAGGTTCTTGG + Intergenic
906883503 1:49619029-49619051 TTTTCGAAGGGAATGCTTCCAGG - Intronic
908339861 1:63165862-63165884 TTGTGGAAGGAAAAGATACATGG + Intergenic
909302812 1:74035621-74035643 TTCTTGAAAGGAAAGTTTTATGG + Intronic
911333097 1:96548118-96548140 TTGCCGAAAGCAAAGTTCCAGGG - Intergenic
912415513 1:109505906-109505928 TAGTCAAAGGGAAAGGTTAAAGG + Exonic
914674262 1:149896368-149896390 TTGTGGGAGGGAAAGTGTCAAGG - Intronic
915679656 1:157568552-157568574 TTGGCAAAGGGAAACATTCAGGG - Intergenic
916393315 1:164357246-164357268 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
917311269 1:173681295-173681317 TTGTCTAAGGGAAATTATAATGG - Intergenic
921669368 1:217909107-217909129 ATGTCGTAGGGAATGCTTCAGGG - Intergenic
922957386 1:229614784-229614806 TTCTCTAATGAAAAGTTTCATGG - Intronic
924138391 1:240996213-240996235 TGGTCTTAGGGAATGTTTCATGG + Intronic
924690370 1:246343779-246343801 TTGTAGAAGGGTAAGAGTCAGGG - Intronic
1066322986 10:34324389-34324411 TTGTCGGGGGAAAAGTTTCTTGG + Intronic
1069263457 10:66429813-66429835 TTTTCAAAGGGAATGTTTCCAGG - Intronic
1072210866 10:93246082-93246104 ATTTCGAAGGGAATGTTTGAGGG - Intergenic
1074115111 10:110451124-110451146 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
1075921060 10:126213784-126213806 TTTTGGCAGGGAAATTTTCAAGG - Intronic
1076870930 10:133194305-133194327 GTGTCAAAGAGAAAATTTCAAGG + Intronic
1079372766 11:19865650-19865672 TAGTAGAAGGGAAAAATTCAAGG + Intronic
1082568571 11:54710649-54710671 TTGTCAAAGGGAATGCTTCCAGG + Intergenic
1083003313 11:59317549-59317571 TTTTCAAAGGGAATGTTTCCAGG + Intergenic
1086508849 11:87533589-87533611 TTGAAGAAAGGAAAGTTTCACGG - Intergenic
1091562015 12:1621959-1621981 TGGTCAAAGAGAAAATTTCAAGG - Intronic
1093719643 12:22424816-22424838 GTGTCAAAGTGAAAGTTACAAGG + Intronic
1093720139 12:22431456-22431478 GTGTCAAAGTGAAAGTTACAAGG + Intronic
1093984606 12:25516031-25516053 TTCTTCAAGGGAAAGTTACATGG - Intronic
1095586024 12:43850221-43850243 TTGCCTAAGGGAAGGATTCATGG + Intronic
1095671331 12:44863552-44863574 TTGTTGAAGGGAATGTTTGCTGG - Intronic
1095866447 12:46978007-46978029 TTGTCTGGGGGAAAGTCTCATGG + Intergenic
1099515630 12:83593620-83593642 TTTTCAAAGGGAAAGCTTCCAGG - Intergenic
1103192271 12:119011748-119011770 TTGTAGAAGGGACAGACTCAGGG - Intronic
1103959556 12:124600440-124600462 TTTTCTGAGGGAAACTTTCAGGG - Intergenic
1103976139 12:124704004-124704026 ATAGCGTAGGGAAAGTTTCAAGG + Intergenic
1105875084 13:24545097-24545119 TTTTCAAAAGGATAGTTTCAAGG - Intergenic
1105926042 13:25009357-25009379 TTTTCAAAGGGAAAGCTTCCAGG + Intergenic
1106768157 13:32936606-32936628 TCTTCTAAGGAAAAGTTTCAGGG - Intergenic
1108225132 13:48281658-48281680 TTGTGAAAGGGAAAATTTAAAGG + Intergenic
1108704956 13:52976709-52976731 TTCTAGAAGGTAAAATTTCAGGG + Intergenic
1109009304 13:56919919-56919941 TTGTAGGAGGGTCAGTTTCATGG + Intergenic
1110277303 13:73654425-73654447 TTGAGGTTGGGAAAGTTTCAAGG + Intergenic
1113295563 13:108955481-108955503 TTGACAAAGGGAATGTTTCCTGG - Intronic
1114948924 14:27722281-27722303 TCTTCAAAGGGAAACTTTCAGGG - Intergenic
1116993518 14:51299918-51299940 TTGTAGAAGGGAAAGACACAAGG - Intergenic
1117783214 14:59256233-59256255 TTATCAAAGGGAAAGTATTAGGG + Intronic
1122539017 14:102486543-102486565 CTGTGGAAGGGGCAGTTTCATGG - Intronic
1123579761 15:21704910-21704932 TTGTCTCAGGGAAGGGTTCATGG - Intergenic
1123616388 15:22147421-22147443 TTGTCTCAGGGAAGGGTTCATGG - Intergenic
1125832293 15:42725559-42725581 TTGTGGAAGGAAGACTTTCAGGG - Exonic
1126111277 15:45176187-45176209 TTGTCGAAGGGAAAGTTTCAAGG - Intronic
1127451963 15:59125288-59125310 TTCTAGAAAGGAAAGTGTCATGG - Intergenic
1128904728 15:71456789-71456811 TTTTTGAAGGGAAAATTTCTTGG - Intronic
1128943222 15:71805490-71805512 TTTTCCAAGGGATAGTTTCCTGG + Intronic
1129077955 15:73013761-73013783 TTGTTGAAGGGCAGATTTCACGG + Intergenic
1132052178 15:98616228-98616250 TTCTCAAAGAGAAGGTTTCAAGG + Intergenic
1132381580 15:101370119-101370141 TTTTGGAAGGCAAGGTTTCAGGG + Intronic
1202988631 15_KI270727v1_random:439155-439177 TTGTCTCAGGGAAGGGTTCATGG - Intergenic
1133829837 16:9311285-9311307 TTGTCAAGGAGAAAGATTCAGGG + Intergenic
1135897678 16:26423298-26423320 TTTTCCAAGGGAAAGTTTCCAGG - Intergenic
1138041195 16:53669786-53669808 ATGTGGAAGGGAAACATTCATGG - Intronic
1142944522 17:3413271-3413293 TTTGAGATGGGAAAGTTTCACGG + Intergenic
1144126907 17:12211469-12211491 TTGACCAAGGCAAAGTTTTAAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1155859943 18:30884987-30885009 ATGTGGAAGGGAAACTTACAAGG - Intergenic
1156528646 18:37793923-37793945 TTGTCAAAAGGAAAGTCTCCTGG - Intergenic
1163976275 19:20856105-20856127 TTTTCAAAGGGAATGTTTCCAGG - Intronic
1165686876 19:37829535-37829557 TAGTAGAAGAGAAAATTTCAAGG - Intergenic
1166773255 19:45297448-45297470 TTGAAGAAGGGACAGTTTGAAGG + Intronic
927554037 2:24020169-24020191 TTGGGGAAGGGAAAGTATCAAGG + Intronic
928301115 2:30125563-30125585 TGGGCCAAGAGAAAGTTTCAAGG + Intergenic
928482174 2:31693837-31693859 TTGTGTAAAGCAAAGTTTCAGGG + Intergenic
929054636 2:37865468-37865490 ATGTCTAAGGGAAAAGTTCATGG - Intergenic
929838391 2:45429701-45429723 TTTTCAAAGGGAACGTTTCCAGG - Intronic
931928834 2:67106108-67106130 ATGTCAAAGGGCAAATTTCACGG - Intergenic
933694659 2:85208722-85208744 TTGTGGAAGGGACAATTCCAGGG + Intronic
937267002 2:120623068-120623090 TTGTGGAAGGAAAGGTTTCGTGG + Intergenic
938470451 2:131554979-131555001 TTATCGAAGGCAAAGTTTTCTGG + Intergenic
939389425 2:141547069-141547091 TTGTCGTAGGTAAACATTCATGG + Intronic
943801914 2:192070953-192070975 TTGTCGAGTGGAAAGTGACACGG + Intronic
944036882 2:195305112-195305134 TTCTCAAGGGGAAAATTTCAAGG - Intergenic
944965035 2:204921740-204921762 TTTTAGAAAGAAAAGTTTCATGG + Intronic
946621538 2:221569272-221569294 TTGTGGAAGGGAAAATGTTAGGG - Intronic
1169337289 20:4766724-4766746 CTGTAGAAGTGAAAGTTCCATGG - Intergenic
1169643696 20:7784550-7784572 TAATCGAAGAGAAAGTTTCAAGG - Intergenic
1174265415 20:49328322-49328344 TTGTCATAGGGAAACTTTCAAGG + Intergenic
1177084358 21:16683946-16683968 TTGTAAAAGTGAAAGTTTCAAGG - Intergenic
1177278088 21:18942109-18942131 TTGTGGAAGACAAATTTTCATGG - Intergenic
1178793285 21:35720282-35720304 TTTTCAAAGGGCAAGTTTCAAGG - Intronic
1181857682 22:25793780-25793802 TTGTCTGAGGTAAAGTCTCAAGG - Intronic
1182978580 22:34646725-34646747 TTGAGGAAGGGACAGTTTGAAGG - Intergenic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
960112565 3:113859310-113859332 GGGTCAAAGGGAAAGTCTCAAGG - Intronic
964222758 3:154365678-154365700 TTGTGGAAGGCAAAATTTAAGGG - Intronic
965325128 3:167293606-167293628 TTTTCAAAGGGAATGTTTCCAGG - Intronic
966647749 3:182265790-182265812 TTGGTGAAGGGAAAATTTCTAGG - Intergenic
972229919 4:37059913-37059935 TTGTCAAAGGGAGAGTTAGAGGG + Intergenic
972892434 4:43575483-43575505 TTTTCAAAGGGAATGCTTCAAGG - Intergenic
972927004 4:44021731-44021753 TGGTAAAAGGGAAAGTTGCAGGG - Intergenic
973151262 4:46891260-46891282 ATGTCCAAGGGAAAGATTCAAGG + Intronic
974150432 4:58000590-58000612 TTGTCCTAGAGAATGTTTCAGGG + Intergenic
975633742 4:76425333-76425355 TTGGCCAAAGAAAAGTTTCAAGG - Intergenic
975826165 4:78321500-78321522 TTGACAAAGGGAAGGTTTCTGGG + Intronic
979290380 4:118973519-118973541 TTGGTGAAGGGAAATTTTTATGG - Intronic
979438090 4:120718901-120718923 TTGCAGAAGAGAAAGTTTGAGGG - Intronic
980311133 4:131130158-131130180 TTGTACAGGGCAAAGTTTCAAGG - Intergenic
982060444 4:151599315-151599337 TTGTCAAAGCTAAATTTTCAAGG + Intronic
985249715 4:188011952-188011974 TTGTAGAGGGGAAAGCTTTATGG + Intergenic
988322369 5:29714875-29714897 TTGTCAAAGGGAATAATTCATGG - Intergenic
989419272 5:41217073-41217095 TTGGGGAAGAAAAAGTTTCAAGG - Intronic
990744707 5:58947860-58947882 TTGTTGACTGGAAAGCTTCATGG - Intergenic
994574208 5:101555618-101555640 TTTTCGAAGGGAATGCTTCCAGG - Intergenic
996290544 5:121846903-121846925 TTGATGAATGGGAAGTTTCAGGG - Intergenic
1000634369 5:163627157-163627179 TTTCCGCAGGGAAAGTCTCAGGG - Intergenic
1009827017 6:68879650-68879672 TGGTCTTGGGGAAAGTTTCAGGG + Intronic
1014229001 6:118881328-118881350 TTGGGAAATGGAAAGTTTCAAGG - Intronic
1014583913 6:123174314-123174336 TTGTCAAAGGGGAAGTTTACGGG + Intergenic
1021506857 7:21395726-21395748 TTTTGCAAGGGAAAATTTCATGG - Intergenic
1022077119 7:26982865-26982887 AAGTCGAAAGGAAAGTTTGATGG - Intronic
1022126172 7:27359630-27359652 TAGTGGAAGGCAGAGTTTCATGG + Intergenic
1022538034 7:31110099-31110121 TTGTGGAAGGGAAAGCTCAAAGG + Exonic
1024414426 7:49087029-49087051 TTGTCTAAGAGCAAGTTTCGAGG + Intergenic
1028436885 7:90814288-90814310 CAGTCGGAAGGAAAGTTTCAGGG + Intronic
1031039061 7:116819606-116819628 TTTTAGATGGGAAAGTTACATGG - Intronic
1031680330 7:124665106-124665128 TTGTACAATAGAAAGTTTCAGGG + Intergenic
1034020665 7:147638498-147638520 TTCTCGCAGTGAAATTTTCAGGG + Intronic
1034130825 7:148715460-148715482 CTGTCGAACTAAAAGTTTCATGG + Intronic
1034321973 7:150193651-150193673 ATGTCAAAAAGAAAGTTTCAAGG - Intergenic
1035237257 7:157506523-157506545 TTTTGGTTGGGAAAGTTTCAGGG + Intergenic
1038964051 8:32551509-32551531 CTGTTGGAGGGAAATTTTCAGGG + Intronic
1039263506 8:35799304-35799326 TTGTGTGAGGGAAAGTTCCATGG + Intergenic
1039563822 8:38535181-38535203 ATGTCAAAAAGAAAGTTTCAAGG - Intergenic
1041113896 8:54515192-54515214 AGGTCAAAGAGAAAGTTTCAAGG + Intergenic
1042973414 8:74436387-74436409 TTTAGGAAGGAAAAGTTTCAAGG - Intronic
1043111796 8:76194116-76194138 TAATCTAAGGAAAAGTTTCATGG + Intergenic
1043128322 8:76428769-76428791 TTGTGGAAGGGAGAGCATCAGGG - Intergenic
1045572658 8:103385539-103385561 TTGTCAAAGGGAATGCTTCCAGG - Intergenic
1048292357 8:133190838-133190860 TTCTTAAAGGGAAAGTTACAAGG - Intergenic
1052806224 9:33015834-33015856 TTGATGAAGGGAAACTCTCATGG - Intronic
1061597523 9:131641491-131641513 TTGAAGAAGGGAGAGTTACAGGG - Intronic
1188459799 X:30411338-30411360 TTGTTGAAGGAAACGTTACATGG - Intergenic
1188604386 X:32010620-32010642 TTCTAGGAGGGAAATTTTCAAGG - Intronic
1188714725 X:33447954-33447976 TTGTGGAAGGGAATGTGTCGAGG + Intergenic
1191055133 X:56232990-56233012 TTGTCCAAGGAAAAGCTGCAGGG + Intronic
1192253660 X:69435804-69435826 TTTTCAAAGGGAATGTTTCCAGG + Intergenic
1194442296 X:93947684-93947706 CTGATGAAGAGAAAGTTTCAAGG - Intergenic
1195069920 X:101268959-101268981 TTGACAAAGAGAAAGTCTCATGG + Exonic
1195149530 X:102051965-102051987 TTTTCAAAGGGAAAGCTTCCAGG + Intergenic
1196120307 X:112042980-112043002 TGGTAGAAAGGAAGGTTTCATGG - Intronic
1197229886 X:123992512-123992534 CTGTAGTAGGGAGAGTTTCATGG + Intronic
1197312699 X:124925677-124925699 TTGTCAAAGGAATAGTTACAAGG + Intronic
1198260641 X:134961807-134961829 AAGTCGAAAGGAAAGTTTGATGG - Intergenic
1199773179 X:150987792-150987814 AAGTCGAAAGGAAAGTTTGATGG + Exonic
1201353812 Y:13075811-13075833 TTTTCAAAGGGAATGTTTCCAGG - Intergenic
1201394401 Y:13532916-13532938 TTTTCAAAGGGAATGTTTCCAGG + Intergenic
1201854396 Y:18525357-18525379 TTGTCAAAGGGAATGTTTCCAGG - Intergenic
1201878925 Y:18795028-18795050 TTGTCAAAGGGAATGTTTCCAGG + Intronic
1202112692 Y:21440252-21440274 TTTTCAAAGGGAAAGCTTCCAGG + Intergenic