ID: 1126112444

View in Genome Browser
Species Human (GRCh38)
Location 15:45183652-45183674
Sequence GGACCATGGGTGGGAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126112444_1126112455 10 Left 1126112444 15:45183652-45183674 CCAGTAGCTCCCACCCATGGTCC 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1126112455 15:45183685-45183707 AGCTGTTCCTGGCTCCCAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 207
1126112444_1126112452 -1 Left 1126112444 15:45183652-45183674 CCAGTAGCTCCCACCCATGGTCC 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1126112452 15:45183674-45183696 CTCAGGGTCCCAGCTGTTCCTGG 0: 1
1: 0
2: 3
3: 33
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126112444 Original CRISPR GGACCATGGGTGGGAGCTAC TGG (reversed) Intronic
900495103 1:2972624-2972646 GTAGCATGGGTGGGAGCCCCGGG - Intergenic
900576363 1:3384380-3384402 TGACCATGGGTGGCGGCTGCAGG - Intronic
901423857 1:9168815-9168837 GGACCCCGGATGGGGGCTACAGG - Intergenic
901818176 1:11806574-11806596 GAAACATGGGTGGGATTTACTGG - Intronic
901831231 1:11893925-11893947 GGTCCTTGGGTGGGTGCTCCTGG - Intergenic
903208273 1:21799401-21799423 GATCCATGGGTGGTAGCTAAGGG - Intergenic
904041540 1:27587990-27588012 GGACCAGGGGAGGGAGAGACTGG - Intronic
904604898 1:31692827-31692849 GGATCAGGGGTGGGAACTCCTGG + Intronic
905224161 1:36468206-36468228 GGGGCATGGGAGGGAGCTATGGG + Exonic
907467565 1:54649391-54649413 GGGGCTTGGGTGGGATCTACAGG - Intronic
911984779 1:104608654-104608676 GGACAGTGGGTGCAAGCTACTGG + Intergenic
915471931 1:156130784-156130806 GGGCCATGGGTGGGCCCTGCAGG - Intronic
918078507 1:181188702-181188724 GTACCATGGGTAGCAGCTGCGGG - Intergenic
918341665 1:183572948-183572970 CGACCCTGGGTGAGAGCCACAGG - Intronic
922327796 1:224545223-224545245 CCACCATGTGTAGGAGCTACAGG - Intronic
922351427 1:224737424-224737446 GGACCCTGGGTGGCCGCCACGGG + Intronic
923569192 1:235099148-235099170 GGAGCACAGGTGGGAGCCACCGG - Intergenic
924836851 1:247657358-247657380 GGATTATAGGTGGGAGTTACTGG + Intergenic
1063610423 10:7557416-7557438 GGGCCATGGAGGGAAGCTACGGG + Intergenic
1064203224 10:13301389-13301411 GGAACATGACTGGGGGCTACAGG - Intronic
1066300871 10:34094437-34094459 GGACCATGGCTGAGAGGGACTGG - Intergenic
1066465499 10:35646491-35646513 GGACCACAGGTGCGTGCTACAGG - Intergenic
1068428396 10:56898341-56898363 GGAGAATGGGTTGGAGCCACTGG - Intergenic
1069040375 10:63689904-63689926 GAACCATTGGTGGGAGGTAGGGG - Intergenic
1072228265 10:93389927-93389949 GGACCACTGCTGGGAGCTACAGG + Intronic
1072295843 10:94008924-94008946 GAACCATGGATGGGTGCTAGAGG + Intronic
1073947640 10:108769216-108769238 GGGCCATGTGTTGGAGCTCCTGG - Intergenic
1075182703 10:120226113-120226135 GGACTATGGGCGTGAGCCACCGG - Intergenic
1075346440 10:121685554-121685576 GGAACATGGGTGGGATCTGGTGG + Intergenic
1076245550 10:128944968-128944990 GGACCATGGGTTGGTGTTCCAGG - Intergenic
1076245884 10:128947315-128947337 GGACCATGGGTTGGTGTTCCAGG - Intergenic
1076788951 10:132766865-132766887 GGAGCCTGGGTGGGAGCTGGAGG + Intronic
1076788986 10:132766977-132766999 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1076788995 10:132767010-132767032 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1076789013 10:132767078-132767100 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1076789022 10:132767111-132767133 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1076789042 10:132767181-132767203 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1076789051 10:132767214-132767236 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1076789071 10:132767284-132767306 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1076789080 10:132767317-132767339 GGAGCTTGGGTGGGAGCTGGAGG + Intronic
1078249915 11:9608459-9608481 GGAAGATGGGTGGGAGCTAATGG - Intergenic
1078815033 11:14812087-14812109 TGACTATGGGTAGGAGCGACAGG + Intronic
1080699947 11:34636378-34636400 GGATCATGGTTGGGAGCCCCAGG - Intronic
1081661128 11:44889180-44889202 GGACCAAGGGTGGGAGAAACAGG - Intronic
1082109853 11:48262551-48262573 GGAGCATGGTGGGGAGCTAAAGG + Intergenic
1084077175 11:66788892-66788914 GGACTACAGGTGGGAACTACTGG + Intronic
1084843075 11:71874041-71874063 GGATTATGGGTGTGAGCCACTGG - Intronic
1085821083 11:79794391-79794413 GGACAAGGGGTGGGAGGCACTGG + Intergenic
1089084913 11:115808756-115808778 GGTTCCTGGGTGGGAGCCACAGG + Intergenic
1089760726 11:120721158-120721180 GGTCCCTGGTTGGGAGCTACGGG + Intronic
1089923070 11:122229230-122229252 GGAAAATGAGTGAGAGCTACTGG + Intergenic
1100367481 12:93935089-93935111 GGACCCTGGGTGGGGGCCACAGG - Intergenic
1102571303 12:113828638-113828660 TCCCCAAGGGTGGGAGCTACAGG - Intronic
1106174338 13:27316716-27316738 GATCCATGGGTGAGAGTTACAGG + Intergenic
1108356233 13:49630882-49630904 GGACCACTGCTGGGAGCTCCGGG + Exonic
1108368310 13:49740805-49740827 GGGCCAGGGGTGGGGGGTACAGG - Intronic
1109277636 13:60320431-60320453 GGGGCATTGGTGGGAGCTACAGG - Intergenic
1109927772 13:69168383-69168405 GTGCCATGGGTGTGAGCTAAAGG + Intergenic
1111806375 13:93043921-93043943 GGTCCATGGTTGGGATCCACGGG - Intergenic
1112957060 13:105073226-105073248 GGAGCATGGGGTGGAGCCACGGG - Intergenic
1118397819 14:65352621-65352643 GGATCATGGGTGTGAGCCACCGG - Intergenic
1120045530 14:79801687-79801709 GCACCATTGCTAGGAGCTACTGG + Intronic
1121430222 14:93881260-93881282 GAAACATGGCTGGGAGCTAGAGG + Intergenic
1121885870 14:97542293-97542315 GGAACAGCGGTGGAAGCTACAGG - Intergenic
1122769506 14:104091763-104091785 TGACCATGGCTGGGATCTGCAGG + Intronic
1122986014 14:105211934-105211956 GGCCCGAGGGTGGGAGCTCCCGG - Intronic
1124198514 15:27656387-27656409 GGCCCAGGTGTGGGATCTACTGG - Intergenic
1126112444 15:45183652-45183674 GGACCATGGGTGGGAGCTACTGG - Intronic
1126916574 15:53472954-53472976 GGTCAGTGGGTGGAAGCTACAGG + Intergenic
1128627253 15:69222312-69222334 GCACCATGGGTGGGAGGCAGGGG + Intronic
1129104730 15:73298554-73298576 GGATCATAGGTGGGAGGTCCTGG - Exonic
1129561868 15:76578438-76578460 GGCCCAGTGGTGGGGGCTACAGG + Intronic
1130320275 15:82835699-82835721 GGAACCTGGGTGGGAGCGGCAGG - Exonic
1130812110 15:87390491-87390513 GGACCATGAATGGAAGCTGCAGG + Intergenic
1132850844 16:2024240-2024262 GGACCAGGGCTGAGAGCTTCCGG + Intergenic
1136360658 16:29777464-29777486 GGATTATGGGTGTGAGCCACTGG + Intergenic
1137625324 16:49904075-49904097 GGACCGTGGGTGGGAGGACCAGG - Intergenic
1138200788 16:55086788-55086810 TTTCCATGGGTGGGTGCTACTGG + Intergenic
1142215521 16:88827877-88827899 CGACACTGGGTGGGAGCTCCAGG - Intronic
1142284429 16:89165946-89165968 GGGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284470 16:89166106-89166128 GGGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284569 16:89166508-89166530 GGGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284609 16:89166668-89166690 GGGCCATGGGTGGGATTTGCTGG + Intergenic
1143556953 17:7667982-7668004 GGAACAGGGGTGGGTGCTACTGG - Intronic
1143584567 17:7844772-7844794 GGACCCTAGGTGGGAGCCGCGGG + Intronic
1145915353 17:28570948-28570970 GCACCATGAGGCGGAGCTACAGG + Exonic
1148872011 17:50663833-50663855 GGATCATGGGTGTCATCTACAGG + Exonic
1151247823 17:72808783-72808805 CGACTCTGGGTGGGAGCCACAGG - Intronic
1152598646 17:81250504-81250526 GGAGCAGGTGTGGGAGCTCCGGG - Intronic
1152633240 17:81420065-81420087 GGACCCTGGATGGGGGCTGCTGG + Intronic
1153955588 18:10093044-10093066 GGGCGAAGGGTGGGAGCTACGGG + Intergenic
1154163517 18:11997179-11997201 GGACCATGGGCAGATGCTACGGG + Intronic
1160781747 19:880461-880483 GGACCAAGGGTTGGGGCTCCTGG + Intronic
1161634711 19:5380506-5380528 GGAATATGGGTGGGTGCTAAGGG - Intergenic
1162137138 19:8562442-8562464 GGCCTATGGGTGGAAGCCACTGG + Intronic
1162450673 19:10752543-10752565 GGGCCCTGGCTGGGAGTTACTGG + Intronic
1164425693 19:28139442-28139464 GGAACATGGCTGGGAGTCACAGG - Intergenic
1165291907 19:34892425-34892447 GGACCAAAGGAGGCAGCTACAGG - Intergenic
1165342614 19:35223689-35223711 GGACCTGGGGTGGGCGCTTCAGG + Intergenic
1165356931 19:35310173-35310195 GGACTTGGGGTGGGAGCCACAGG + Intronic
1165452212 19:35890259-35890281 GGACGATGTGTGGGATCTGCAGG - Intronic
1166358593 19:42242283-42242305 GGGCCATGGGTGGGGGCGTCGGG - Exonic
1167422431 19:49412196-49412218 GAACCATGTGAGGGACCTACTGG + Intronic
925453936 2:3997788-3997810 GGAAAAGGGGTGGGAGCTCCTGG + Intergenic
927109307 2:19852793-19852815 GGACCATAGGTGTGACCCACGGG - Intergenic
927970252 2:27301409-27301431 GGATTATAGGTGTGAGCTACCGG + Intronic
928571891 2:32617472-32617494 GCAGCATGGGTAGGATCTACTGG + Intronic
933018109 2:77156841-77156863 GGACTATAGATGTGAGCTACAGG + Intronic
935963212 2:108447646-108447668 GGTCCATGAGTTGCAGCTACAGG - Intergenic
937812037 2:126210046-126210068 GGAGTATGGGTGGGAGGTATGGG + Intergenic
939957642 2:148540116-148540138 GGCCCATGCGTGGGAGCCACTGG - Intergenic
947617656 2:231568754-231568776 GGACCCTGGGGGGAAGCTGCAGG - Intergenic
947887522 2:233585531-233585553 TGCCCATGGATGGGAGCCACTGG + Intergenic
947889393 2:233603644-233603666 TGCCCATGGATGGGAGCCACTGG + Intergenic
947893643 2:233647927-233647949 TGCCCATGGATGGGAGCCACTGG + Intronic
947895926 2:233672026-233672048 TGCCCATGGATGGGAGCCACTGG + Exonic
947896807 2:233682029-233682051 TGCCCATGGATGGGAGCCACTGG + Exonic
948687679 2:239679245-239679267 GGACCATGGGTCTGAGCAGCAGG - Intergenic
948992159 2:241560691-241560713 GGTCTCTGGGTGGGAGCTAGGGG + Intronic
1168803789 20:661449-661471 TGACCCTTGGTGGCAGCTACAGG + Intronic
1169194141 20:3674303-3674325 GGACCCTGAGTGGAAGCTGCTGG + Intronic
1170703759 20:18727148-18727170 GGCCCATGGGTGGGAGCAGAGGG + Intronic
1171332453 20:24352466-24352488 GGACCTTGTATGGGAGCTGCAGG - Intergenic
1173555942 20:43965746-43965768 GGACCAAGAGTGGGAGCAAATGG + Intronic
1174018805 20:47512297-47512319 GGATTATAGGTGTGAGCTACGGG - Intronic
1175498068 20:59428894-59428916 GGAACATGGGAGGGAGCCAAGGG + Intergenic
1176139407 20:63538383-63538405 GGTCCCTGGGTTGGAGCTCCCGG - Intergenic
1176169229 20:63689561-63689583 GGTCCATGCGTGGGGGGTACGGG - Exonic
1176188605 20:63795638-63795660 GCACGATGGGTGGGAGCACCCGG - Intronic
1176407445 21:6428943-6428965 GGCCCATGGCTGGGAGCAATGGG - Intergenic
1179682950 21:43037346-43037368 GGCCCATGGCTGGGAGCAATAGG - Intergenic
1182316046 22:29448130-29448152 GGACCCACCGTGGGAGCTACAGG + Intergenic
1183206967 22:36426335-36426357 GGTCCCTGTGTGGGAGCTCCAGG - Intergenic
1183248645 22:36712731-36712753 GGTGCATTTGTGGGAGCTACAGG + Intergenic
1184583835 22:45434530-45434552 GGACCACGGGTGGGACCCAGGGG + Intergenic
1185081638 22:48712684-48712706 GGACCCTGGGTGGGTGTTTCAGG + Intronic
1185097799 22:48821227-48821249 GGACCAAGGGCGGGGGGTACTGG - Intronic
949905517 3:8855369-8855391 GATCCATAGGTGGCAGCTACAGG - Intronic
954218492 3:49137909-49137931 GGACTGTGGGTGGGAGCCATGGG - Intergenic
954806320 3:53222900-53222922 GGACCTTTGGTGGGAGCAAGGGG + Intergenic
961216249 3:125162857-125162879 GGACCCTTGGTATGAGCTACTGG - Intronic
961809365 3:129513071-129513093 GGACCCTGGGTGGGAGGGGCCGG + Intronic
961999417 3:131279619-131279641 AGACCATGGTTGTGAGGTACAGG - Intronic
963292236 3:143503697-143503719 AGACCATGGGTGGCCGCTCCGGG - Intronic
964468454 3:157025015-157025037 TGACCATGAGTGAAAGCTACTGG - Intronic
965091237 3:164164949-164164971 GGATTATGGGTGTGAGCCACTGG - Intergenic
968524504 4:1049171-1049193 GGACCCTGGGCAGGAGCTGCTGG - Intergenic
968627657 4:1634450-1634472 GGAACAGGGGAGGGAGCTGCTGG - Intronic
969174126 4:5385981-5386003 GGGCCATGGGTGGGGGCTGTGGG - Intronic
969784162 4:9440102-9440124 GGATTATGGGTGTGAGCCACTGG - Intergenic
973586503 4:52397641-52397663 GGACCATGGGGGTGAGGTACAGG - Intergenic
974070844 4:57122075-57122097 GGACCAGGGGAGGGAGCTGATGG - Intergenic
974433841 4:61832269-61832291 GGACAAAGGATGGGACCTACAGG + Intronic
975383544 4:73729437-73729459 GGATTATAGGTGTGAGCTACTGG + Intergenic
976454260 4:85228140-85228162 GAACCATTGCTGGGAGCTAGTGG + Intergenic
976711436 4:88075609-88075631 GGAAGATGGGCGGGAGCTTCTGG - Exonic
982209791 4:153025041-153025063 GCTCCATGGGTGGGTGCTCCAGG + Intergenic
987054987 5:14182898-14182920 AGAGCAAGGGTGGCAGCTACAGG + Intronic
988068234 5:26250888-26250910 GGACCTTGAGTGGGAGGTGCGGG - Intergenic
989445673 5:41525553-41525575 GGATTATAGGTGTGAGCTACTGG + Intergenic
990582590 5:57179866-57179888 GGATTATGGGTGAGAGCCACTGG + Intronic
994289866 5:98015707-98015729 GGACCACAGGTGTGAGCCACTGG + Intergenic
994710055 5:103255870-103255892 GAACCATAGGTGGCAGCTCCAGG + Intergenic
997208993 5:132066707-132066729 GGACCAGGGGTGGGGGCTAGGGG + Intergenic
997976928 5:138446222-138446244 GGACCCTGGGTGGGGCCTCCAGG + Exonic
999091110 5:148936580-148936602 GGACAATGGGCAGGAGCTATGGG + Intronic
999998445 5:157114706-157114728 GGATTATAGGTGTGAGCTACTGG + Intronic
1004558739 6:16726591-16726613 GGACTATAGGTGTGAGCTACCGG - Intronic
1006007410 6:31013396-31013418 GGATTACGGGTGTGAGCTACCGG + Intronic
1006056699 6:31390563-31390585 GGAGGATGGGGTGGAGCTACCGG - Intergenic
1006069419 6:31487478-31487500 GGAGGATGGGGTGGAGCTACCGG - Intergenic
1006730219 6:36230805-36230827 GGACCTTGGGTGGGAGTTTTTGG - Exonic
1006882767 6:37354260-37354282 GGAAGATGGGTGCGAGGTACGGG + Exonic
1007625529 6:43244105-43244127 GGACCATGGGAGGGATCTCTGGG - Intronic
1015499849 6:133920807-133920829 GAACCATGGCTGGGAATTACTGG + Intergenic
1015769301 6:136752681-136752703 GGATTATGGGTGTGAGCCACTGG + Intronic
1017162984 6:151382824-151382846 GGACTATGGGCGTGAGCCACTGG + Intronic
1017404390 6:154102634-154102656 GGGAGATGGGTGGGTGCTACTGG - Intronic
1022510465 7:30932071-30932093 GGAGCATGGGTGGCACCTATTGG - Intergenic
1023155708 7:37249805-37249827 GGATTATAGGTGTGAGCTACCGG - Intronic
1024043482 7:45572897-45572919 GGGCCTTTGGTGTGAGCTACTGG + Intergenic
1026151663 7:67792947-67792969 GGAACATGGGTTGAAGCTACTGG + Intergenic
1028586004 7:92452447-92452469 GGAGCCTGAGTGGGAGCCACTGG + Intronic
1028873895 7:95799240-95799262 GGACTACAGGTGGGTGCTACTGG - Intronic
1029733718 7:102454121-102454143 GGATTATAGGTGTGAGCTACAGG - Exonic
1030868370 7:114727316-114727338 GGAACATGGATGGGAGCTAGAGG - Intergenic
1034584291 7:152075528-152075550 GGATTATGGGCGGGAGCCACGGG - Intronic
1035180996 7:157089505-157089527 GGACCATGAAAGGGAGCAACAGG + Intergenic
1035284777 7:157799205-157799227 GGAGCGTGGGTGGGAGGTGCTGG + Intronic
1035382479 7:158448610-158448632 GGCCCAGGAGTGGGAGCTGCAGG - Intronic
1036026624 8:4915970-4915992 GGACCAGGGATGGGAACTAGCGG - Intronic
1036834875 8:12054026-12054048 GGATTATGGGTGTGAGCTACTGG + Intergenic
1036856718 8:12300590-12300612 GGATTATGGGTGTGAGCTACTGG + Intergenic
1038426288 8:27466050-27466072 GGACCCTGGGTGCCAGCTATGGG + Intronic
1039946092 8:42129699-42129721 GGACTACAGGTGTGAGCTACTGG + Intergenic
1040052150 8:43026454-43026476 GGAAGCTGGGTTGGAGCTACTGG + Exonic
1043238687 8:77902724-77902746 GGTGCATGTGGGGGAGCTACAGG - Intergenic
1046039741 8:108888001-108888023 GGACCTCTGGTGGCAGCTACAGG - Intergenic
1049288176 8:141787825-141787847 GGAGCAAGGGTCGGAGCCACGGG - Intergenic
1049813237 8:144585668-144585690 GCACCATGGGCGGGAGGTCCTGG - Intronic
1050168213 9:2788580-2788602 GGAACAAGGGTGGAAGTTACAGG + Intronic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1054393208 9:64632331-64632353 GGATTATAGGTGTGAGCTACCGG - Intergenic
1055193432 9:73556562-73556584 GGACTTTGGGTGGGAAATACAGG - Intergenic
1058600613 9:106665898-106665920 GTACCATGGGTGGGTGTTCCAGG - Intergenic
1058793171 9:108471364-108471386 GGATTATGGGTGTGAGTTACTGG - Intergenic
1060212277 9:121717896-121717918 GGACCTTGGCTGGGGGCTAGAGG - Intronic
1060602290 9:124886354-124886376 AGGCCATGGATGGGAGCTTCAGG + Intronic
1061803875 9:133127623-133127645 GGACCACGCGTGGGAACTCCCGG + Intronic
1186610994 X:11138784-11138806 GGACCGTGGGTGGTGGCCACTGG - Exonic
1188638369 X:32465273-32465295 GAATCATGGGTGAGAGATACTGG - Intronic
1190635208 X:52426298-52426320 GAATGATGGGTAGGAGCTACTGG - Intergenic
1192719591 X:73678356-73678378 GGACCATGGGTGGGCCATGCAGG + Intronic
1194625533 X:96222225-96222247 GGATCATGGGCATGAGCTACTGG - Intergenic
1194653553 X:96544329-96544351 GGATTATGGGTGTGAGCCACTGG + Intergenic
1195989824 X:110671504-110671526 CCACCATGAGTGGAAGCTACTGG - Intergenic
1197763208 X:130042223-130042245 GGACCACGGGTGTGTGCCACCGG + Intronic
1199610601 X:149609703-149609725 GGAACATGGTTGGGTCCTACAGG - Intronic
1199694529 X:150334568-150334590 GGACCCTGGATGGGAGGTAGTGG + Intergenic
1202373424 Y:24213192-24213214 GGACAAGGGGTAGGAGCTGCTGG - Intergenic
1202497357 Y:25456928-25456950 GGACAAGGGGTAGGAGCTGCTGG + Intergenic