ID: 1126118931

View in Genome Browser
Species Human (GRCh38)
Location 15:45233882-45233904
Sequence TCCATTTTAAATAAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126118927_1126118931 15 Left 1126118927 15:45233844-45233866 CCTTTTCCTCTAAATATAATTCC No data
Right 1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG No data
1126118929_1126118931 -6 Left 1126118929 15:45233865-45233887 CCTCCAAATATAATTTCTCCATT No data
Right 1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG No data
1126118928_1126118931 9 Left 1126118928 15:45233850-45233872 CCTCTAAATATAATTCCTCCAAA No data
Right 1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG No data
1126118930_1126118931 -9 Left 1126118930 15:45233868-45233890 CCAAATATAATTTCTCCATTTTA No data
Right 1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126118931 Original CRISPR TCCATTTTAAATAAAATTTC TGG Intergenic
No off target data available for this crispr