ID: 1126121144

View in Genome Browser
Species Human (GRCh38)
Location 15:45252702-45252724
Sequence CATTATAGTCAGGAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126121142_1126121144 -8 Left 1126121142 15:45252687-45252709 CCAATTCTTATGCTACATTATAG 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1126121144 15:45252702-45252724 CATTATAGTCAGGAATTTGAAGG 0: 1
1: 0
2: 1
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126121144 Original CRISPR CATTATAGTCAGGAATTTGA AGG Intronic
905032396 1:34895534-34895556 AAATATAGTTGGGAATTTGAAGG - Intronic
905582846 1:39095253-39095275 GATTATAGTCAGAAATGTGGGGG + Intronic
908606749 1:65805754-65805776 CATTTTACTCAGAATTTTGAAGG + Intronic
909819117 1:80037116-80037138 AATTATAGTCATGAAATTGGGGG - Intergenic
910667890 1:89743839-89743861 CATTATAGTTAGGAATGTGATGG - Intronic
914777124 1:150747730-150747752 AATTGGAATCAGGAATTTGAGGG - Intronic
916775735 1:167962198-167962220 CGTTATATTCAGGTAATTGATGG + Intronic
917533001 1:175853864-175853886 AATTCTAGACAGGAATTAGAAGG + Intergenic
918794651 1:188877436-188877458 CCTTAGGGTCAGGATTTTGAAGG - Intergenic
919145724 1:193632281-193632303 CATTTTATTAAGGAATTTAATGG + Intergenic
919612121 1:199758395-199758417 CATTATTGTCAGCATTTTAAAGG - Intergenic
921585034 1:216936145-216936167 CTCTGTAGTCAGGAATGTGAAGG + Intronic
923416869 1:233771020-233771042 CATTATTGTCAAGAATTCAATGG + Intergenic
924598015 1:245464222-245464244 CAGAATAGTCAGGTCTTTGATGG - Intronic
1065642336 10:27796432-27796454 AATTATAGTCAAAATTTTGAGGG + Intergenic
1067677310 10:48393364-48393386 CATTGTAGTCCAAAATTTGAAGG + Intronic
1071350339 10:84734317-84734339 CATTATATTCTGGAAGTTTAAGG + Intergenic
1072005830 10:91245935-91245957 TGTTGTAGTTAGGAATTTGAAGG + Intronic
1072112895 10:92340115-92340137 AATTGTTGCCAGGAATTTGATGG + Intronic
1073108199 10:101045199-101045221 TATTATAGTCAGCAAGATGAAGG + Intergenic
1076008370 10:126966471-126966493 CATTATAGACAACAATATGAAGG - Intronic
1079869066 11:25772969-25772991 TATTATTGTCAGGATTTTGAGGG + Intergenic
1080153965 11:29086233-29086255 GGTTAAAGTCAGGAGTTTGAGGG + Intergenic
1082032327 11:47614251-47614273 AATCATAGTCAGGAATTTTCAGG - Intergenic
1082592385 11:55028506-55028528 CTTTACATTCAGCAATTTGAAGG - Intergenic
1084036225 11:66512451-66512473 CATTATGGATAGGAATTTGGGGG - Intronic
1086370308 11:86149945-86149967 GGTTATATTTAGGAATTTGATGG - Intergenic
1088838909 11:113605800-113605822 CATTAAAGACAGGAATAAGAAGG - Intergenic
1090626879 11:128615784-128615806 AATTCTAGGCAGGAATTTCAGGG - Intergenic
1095391218 12:41708869-41708891 GATATTTGTCAGGAATTTGAGGG + Intergenic
1095558699 12:43539416-43539438 CTTTATAGTCAGTAGTCTGATGG - Intronic
1096186151 12:49582206-49582228 CTTTGAAGGCAGGAATTTGAAGG - Intronic
1096879105 12:54653157-54653179 CATTATGGTCAGGAAAGTGAGGG + Intergenic
1098775192 12:74604082-74604104 CATAATCATGAGGAATTTGAAGG + Intergenic
1099203205 12:79699423-79699445 GATTATAGTCTGGAAGTTGTTGG + Intergenic
1103449629 12:121019469-121019491 CATAATAGTCAGGAAACTGTAGG - Intergenic
1105741592 13:23330323-23330345 GAATATAGTCAGCAACTTGAAGG - Exonic
1105764963 13:23550055-23550077 TATTATTGACAGGAACTTGAAGG + Intergenic
1106466274 13:30017228-30017250 CTTTATAGTCAGGATTCTGCTGG - Intergenic
1106512108 13:30421452-30421474 CATTTTAGACAGGAAAATGAGGG - Intergenic
1107434494 13:40370333-40370355 GATTTTACTCAGGAATTTCAGGG - Intergenic
1109312242 13:60709654-60709676 TATAGTAGTCAGGAATATGAAGG - Intergenic
1109664060 13:65506677-65506699 TATTATAGTCACAACTTTGATGG + Intergenic
1112096880 13:96143165-96143187 AATGATAGTGAGGCATTTGATGG - Intronic
1117965851 14:61206046-61206068 CATTAGAGTCTGTAATTGGAGGG + Intronic
1118028934 14:61800313-61800335 CATTCTATTCATGGATTTGATGG + Intergenic
1118332725 14:64826334-64826356 CTTTATAGCCAGGCCTTTGAAGG - Intronic
1118792498 14:69107741-69107763 CATTATACTCAGGGATTAGCAGG + Intronic
1119908713 14:78329845-78329867 CATAATATTTTGGAATTTGAGGG + Intronic
1126121144 15:45252702-45252724 CATTATAGTCAGGAATTTGAAGG + Intronic
1126501188 15:49347134-49347156 TAGTATACTCAGGAAATTGAGGG + Intronic
1128373109 15:67055220-67055242 CATTGTTGTCAGGAAGTAGAAGG - Intergenic
1129084369 15:73073058-73073080 CATTACAGTCTGGAGTGTGATGG + Intronic
1129865196 15:78902090-78902112 CATAAGACTCAGGAATTTAATGG - Intergenic
1133607376 16:7400988-7401010 CATGAAACTCAGGAATGTGAAGG + Intronic
1134336798 16:13307586-13307608 CATTGTAATCAGGTATTTGTGGG - Intergenic
1135111166 16:19691827-19691849 CATTCTAGTCAGGGAGCTGAGGG - Intronic
1135302638 16:21344266-21344288 AATTACATTCAGGAATTTAAAGG + Intergenic
1136299398 16:29323482-29323504 AATTACATTCAGGAATTTAAAGG + Intergenic
1137652959 16:50136094-50136116 CCTCATGGACAGGAATTTGAGGG + Intergenic
1138254735 16:55545791-55545813 CAATAAAGTCCGGAATTTAATGG + Exonic
1138634550 16:58327055-58327077 CATTATGATCAGGAATATGACGG - Intronic
1139028434 16:62848685-62848707 TATTAAAATCAGGATTTTGAAGG + Intergenic
1143817113 17:9525916-9525938 CATCATTGTCAGGAAAATGAAGG - Intronic
1144144775 17:12387025-12387047 CATTATAGGTAGGAAGTTGGTGG + Intergenic
1144248161 17:13388142-13388164 CATTTTGTCCAGGAATTTGAGGG - Intergenic
1146282099 17:31551274-31551296 CCTTCTCATCAGGAATTTGAAGG - Intergenic
1150194993 17:63288524-63288546 AGTTATATTCAGGTATTTGATGG + Intronic
1155577938 18:27268565-27268587 TATTATAATCAGTAACTTGATGG - Intergenic
1155729113 18:29130130-29130152 TATTCTAGTTAGGAAGTTGAGGG - Intergenic
1156899829 18:42287838-42287860 GATTATTGCCTGGAATTTGAAGG + Intergenic
1157001703 18:43534839-43534861 CTTTATAGGCATGAAATTGAAGG - Intergenic
1158157985 18:54446895-54446917 GAATATAGACAGGAATGTGAAGG - Intergenic
1162823729 19:13238270-13238292 CATTCTAGCCAGGAAGTTCAGGG - Intronic
1166525964 19:43509941-43509963 CAGTACAGTCAGGAAGCTGAAGG - Intronic
925793682 2:7520064-7520086 CATGAAAGTAAGTAATTTGAAGG - Intergenic
927482424 2:23464788-23464810 TCTTATGGTCAGGAAGTTGATGG + Intronic
927602709 2:24458534-24458556 CTTTAGAGTCAGGCATTTGGGGG - Intergenic
928365746 2:30700047-30700069 CATTTCAGTCAGTACTTTGAGGG - Intergenic
930000062 2:46855362-46855384 CATAAGAGACGGGAATTTGAGGG + Intronic
932452460 2:71821556-71821578 CATTAGTGTAAGGAATTTGAGGG + Intergenic
932514485 2:72331177-72331199 TATTAGAATCAGGAATTTGCTGG + Intronic
932743882 2:74315011-74315033 CTTTATAGTCATGAAGGTGAAGG - Exonic
932970065 2:76529852-76529874 CATTTTTGTGTGGAATTTGATGG + Intergenic
933058662 2:77706717-77706739 AATCATAGTCAGAAATTTTAAGG - Intergenic
938752188 2:134343315-134343337 CATTATAACCAGTGATTTGAAGG + Intronic
939978120 2:148744439-148744461 CATTAAAATCATGATTTTGAAGG + Intronic
940631880 2:156250543-156250565 CATTATAGTAAGGAAAATTATGG - Intergenic
940914497 2:159239559-159239581 CATTACAGTCAGGGATATAAAGG - Intronic
942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG + Intergenic
942796050 2:179820764-179820786 CCTTATAGTAATGAATTTCAAGG + Intronic
943702431 2:191001085-191001107 CAGTAAAGTCAGAAATGTGAAGG - Exonic
943981574 2:194559380-194559402 CATTATAATCAGAAGTTTGTAGG + Intergenic
944109260 2:196114403-196114425 TTTTATAATCAGGCATTTGATGG - Intergenic
944411725 2:199451219-199451241 AATTATGCTCAGGACTTTGAGGG + Intronic
944489257 2:200241221-200241243 AATTTTAGGAAGGAATTTGAAGG - Intergenic
945885380 2:215370468-215370490 CATTATAGTGAGGAATGACACGG + Intronic
947052105 2:226057072-226057094 CAATATAGCCAGGAGTTTGGTGG + Intergenic
947092952 2:226533382-226533404 CATTATATTTAGGATTTTGTAGG + Intergenic
947649395 2:231772546-231772568 CATCATAGGAAGGAATTTTAAGG - Intronic
1174542323 20:51299416-51299438 CATAATAGTAAGGACTTTGTGGG + Intergenic
1175412827 20:58782717-58782739 CATTAAAGTAATGAAGTTGAAGG + Intergenic
1177734377 21:25070603-25070625 ACCAATAGTCAGGAATTTGATGG - Intergenic
1181120543 22:20665406-20665428 CATTATACTCAGCAATGAGAGGG - Intergenic
1182533951 22:30985946-30985968 CATTCTAGTCAGGAGGGTGAAGG - Intergenic
1182867422 22:33616204-33616226 CATAATAGTCAAGAAGTGGATGG + Intronic
949974260 3:9440600-9440622 CATTCTAGCAAGGAATTTGTGGG + Exonic
950627298 3:14256906-14256928 CATTTTAGTGAGGAGTGTGATGG + Intergenic
952529832 3:34252035-34252057 CATTGTTGTCAGGCCTTTGAAGG - Intergenic
954774364 3:53002919-53002941 ACTTGAAGTCAGGAATTTGAGGG + Intronic
955592199 3:60549852-60549874 CATTATGGCCAGGAATATTAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
958052774 3:88369391-88369413 CATTAAAAACAGTAATTTGAAGG + Intergenic
958126417 3:89361998-89362020 AATTATAATCAGGACCTTGAGGG - Intronic
958546695 3:95562349-95562371 TAATTAAGTCAGGAATTTGAGGG - Intergenic
959502447 3:107121972-107121994 TATCTTAGTCAGTAATTTGAAGG - Intergenic
963312389 3:143723020-143723042 AACTATAGTCAGGAAACTGAGGG - Intronic
963553836 3:146760410-146760432 AATTATTGTCAGAAATTTTATGG - Intergenic
966830474 3:184003741-184003763 CATAATCACCAGGAATTTGAGGG + Intronic
967089096 3:186119812-186119834 CATTCCAGTCAGGAATGTGTGGG - Intronic
967238267 3:187410036-187410058 AATTATATTCAAGAATTTAAAGG + Intergenic
967367951 3:188709153-188709175 CATTATATTCATGGATTGGAAGG - Intronic
970635841 4:18009010-18009032 CATTAAAATCAGGAAATTAACGG + Intronic
970696488 4:18684387-18684409 CATTATAATAAGTAATTTGGTGG + Intergenic
973969360 4:56196061-56196083 GATAAGAGTCAGGAATTTGATGG + Intronic
975155207 4:71064412-71064434 CATTAGAGTCATGCCTTTGAAGG + Intergenic
975663304 4:76708601-76708623 CTTTACAGTCAGGTATTGGATGG + Intronic
976778338 4:88731035-88731057 CATTGTAGATAAGAATTTGATGG + Intronic
978330712 4:107610159-107610181 CATCCAAATCAGGAATTTGAAGG + Intronic
978640268 4:110862422-110862444 CATTTTACTCAGTAATTTTATGG + Intergenic
978984733 4:114997842-114997864 TATTATAATCAGGATTTTGATGG - Intronic
981150046 4:141369821-141369843 CATGATAGACTGGAATTTCAAGG + Intergenic
983276460 4:165623185-165623207 CATTATAGTCAATAGTTTGAAGG - Intergenic
983397299 4:167215932-167215954 CATTAAAATCAGAAATTTGCTGG + Intronic
984577239 4:181465090-181465112 AATTATAGTCACAAATTTAAAGG - Intergenic
984955105 4:185037188-185037210 AATTATGGTAAGTAATTTGAAGG - Intergenic
986342043 5:6797890-6797912 CATTCTAGCCATGAAATTGAAGG + Intergenic
987874440 5:23662106-23662128 CATTACAGACAGGACTCTGAAGG - Intergenic
988366207 5:30303516-30303538 CATTATAGTCAAGAAGATGGAGG - Intergenic
988969169 5:36448724-36448746 CATTATAGTCATGTATTTCTTGG - Intergenic
989500467 5:42160654-42160676 CATTTTATTCAGCAATTTAAAGG - Intergenic
990021958 5:51138661-51138683 AATTATTGAAAGGAATTTGAAGG + Intergenic
990633696 5:57698958-57698980 CATTATTCTCAGGAATGTGAAGG - Intergenic
993810807 5:92473601-92473623 CATTCTAATGAGGGATTTGATGG + Intergenic
994524901 5:100893509-100893531 CATTACATTCATGTATTTGAGGG - Intronic
994870780 5:105347741-105347763 CATTATAGGCAGCAATTCCAAGG - Intergenic
995379370 5:111514721-111514743 GATTATAGTCAGGACTTGGCAGG - Intergenic
999996238 5:157095160-157095182 CATTATTGTTAGGATTTGGATGG + Intronic
1004656061 6:17662154-17662176 ATTTAGAATCAGGAATTTGATGG + Intronic
1005053859 6:21711295-21711317 CAGTATAGTCTGGAATTCCATGG - Intergenic
1007450624 6:41938724-41938746 CTTAAAAGTCAGGAATGTGATGG - Intronic
1008197587 6:48543404-48543426 CAATATAAACAGGAGTTTGAAGG - Intergenic
1008902668 6:56639796-56639818 CACTCCAGTCAGGAATCTGAAGG + Intronic
1011678445 6:89759232-89759254 CATTGTAGTCAGGTCTTTAAAGG + Intronic
1013959128 6:115876825-115876847 CATTTTAGTTAGGACCTTGAGGG + Intergenic
1014173253 6:118302893-118302915 CATGATACTCTGGAATTTAAAGG + Intronic
1015652028 6:135473667-135473689 CTTTATATTCAGCACTTTGAGGG + Intronic
1016203824 6:141448414-141448436 CATTATAGTAAGGAATTCAGTGG - Intergenic
1016378853 6:143451854-143451876 GATAATATTCAGGGATTTGAAGG + Intronic
1017372262 6:153725672-153725694 CATTATAGTCAGAAATTCCTGGG + Intergenic
1018736909 6:166693771-166693793 AATTGGAGTCAGCAATTTGAGGG + Intronic
1021295248 7:18897094-18897116 TATTATATTCAGGAAATTCAAGG - Intronic
1023226193 7:37971523-37971545 TGTTATATTGAGGAATTTGAAGG + Intronic
1023492442 7:40758496-40758518 GATTATAGTAAGGTATCTGAAGG - Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024360684 7:48464179-48464201 AAATATAGCCAGGAGTTTGAAGG + Intronic
1027472013 7:78585370-78585392 CATCATACTCAGGTATCTGAAGG + Intronic
1028676350 7:93466986-93467008 AATTGTAGTCAGGACTTTAAAGG - Intronic
1028822131 7:95224465-95224487 GTTTCTAGTAAGGAATTTGAAGG - Intronic
1030515022 7:110528252-110528274 CATAATAGCAAGGAATTTGATGG - Intergenic
1030804456 7:113898013-113898035 CATTATAGTCAATACTTGGAAGG + Intronic
1030907228 7:115201287-115201309 CATTTAAGTCATTAATTTGAGGG + Intergenic
1031114869 7:117656547-117656569 CATTATACAGAGGAATTTGATGG + Intronic
1031293456 7:119969572-119969594 TAATATAGTCAGTTATTTGAGGG - Intergenic
1034013100 7:147551999-147552021 CATAAAAATGAGGAATTTGATGG - Intronic
1035399531 7:158555681-158555703 CAACAGAGTCAGGAATCTGAAGG + Intronic
1035611596 8:969161-969183 CATTCTAGTCAGGTCTTTGAGGG - Intergenic
1036092776 8:5686681-5686703 CATTGTAGTGAGGAATTTGGCGG - Intergenic
1036486766 8:9186410-9186432 TGCTATGGTCAGGAATTTGAGGG - Intergenic
1038891668 8:31732560-31732582 CATTAAAGTCAGGACTTTTAGGG + Intronic
1039327712 8:36503340-36503362 CATAATTCTCAGGAAGTTGAGGG + Intergenic
1040642603 8:49356468-49356490 AATTATAGTCAGGAATTATTGGG + Intergenic
1041352086 8:56957270-56957292 AACTTTAGTCAGGAATTTGGGGG + Intergenic
1041499040 8:58519492-58519514 CATTATACTCATGATTTTGTGGG - Intergenic
1042618548 8:70676966-70676988 TATTATAGTCTGTAATTTTAAGG + Intronic
1045809050 8:106200434-106200456 CTTGATGGTCAGGAATTTGGGGG + Intergenic
1046018687 8:108637115-108637137 CATTATATTCTCTAATTTGAGGG + Intronic
1046751282 8:117929690-117929712 CTTTATAGTTAGGAATTTCTGGG - Intronic
1047079513 8:121443888-121443910 CATTAAAGTCAGGAAAAAGAAGG + Intergenic
1047972227 8:130095115-130095137 GATTATACTCAGCAATATGAAGG - Intronic
1052911547 9:33886924-33886946 CATTTTGGTCAAGAATCTGAAGG - Exonic
1053107902 9:35428547-35428569 CATTCTAGTCAGTCTTTTGATGG - Intergenic
1056070759 9:82984291-82984313 CAATATAGACTGGATTTTGAAGG - Intronic
1057238288 9:93384192-93384214 TATTATAGGCAGTAATTAGATGG - Intergenic
1057522902 9:95774170-95774192 AATTATTTTAAGGAATTTGAGGG + Intergenic
1057534311 9:95883963-95883985 CATTTTAGTCTCAAATTTGAAGG + Intronic
1059616197 9:115953647-115953669 CAATATAGTGTGGAAATTGATGG - Intergenic
1059825329 9:118021961-118021983 GATTCTAGGCAGGTATTTGATGG + Intergenic
1059874738 9:118621630-118621652 CATTATAATCTGGACTTTGCAGG - Intergenic
1060366881 9:123025943-123025965 AATTAAATTCAGGAATTAGATGG - Intronic
1062080238 9:134619907-134619929 TATTATCCTCAGGAAGTTGATGG - Intergenic
1192546330 X:72017905-72017927 AATTAGAGTCAGGAAAATGAGGG - Intergenic
1193793385 X:85843583-85843605 CATTCTTTTCAGGAATTTTATGG + Intergenic
1194425319 X:93730518-93730540 CATTTTAGTCATGATTTTGGGGG + Intergenic
1197272959 X:124445815-124445837 CATTCTAGTCAGGCATCAGATGG + Intronic
1198719557 X:139601447-139601469 AATTATACTCAGAATTTTGAAGG - Intronic
1199132261 X:144203832-144203854 TATTGTATTCATGAATTTGAAGG - Intergenic