ID: 1126123576

View in Genome Browser
Species Human (GRCh38)
Location 15:45274945-45274967
Sequence ATGTTCTTGTGGCATTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126123576 Original CRISPR ATGTTCTTGTGGCATTTTGG TGG Intronic
902162120 1:14539106-14539128 ATGTTGTAGTTTCATTTTGGGGG - Intergenic
902178017 1:14665886-14665908 ATTTTCCTTTGGCAGTTTGGAGG + Intronic
902989992 1:20180609-20180631 TTGTTCGTGTGGCATTTTGAAGG + Intergenic
904663724 1:32104059-32104081 ATGTTCTCTGGGCTTTTTGGAGG + Intergenic
907646415 1:56248627-56248649 ATATTCTTCTGGGATTTTGATGG - Intergenic
909467965 1:75995075-75995097 GTGATCTTTTGCCATTTTGGTGG - Intergenic
910659237 1:89652945-89652967 ATGTTCCCCTGGCATTATGGAGG + Intronic
911819227 1:102395289-102395311 ATGTGCATTTTGCATTTTGGGGG - Intergenic
912483599 1:110005606-110005628 ATGTTGTAGTGGAATTCTGGTGG + Intronic
912869358 1:113289829-113289851 ATGTTCTTGTGGCACTAGTGGGG - Intergenic
913079618 1:115370374-115370396 ATGTGCTTTTGGCATCTTGATGG - Intergenic
913434260 1:118830824-118830846 AGGTTCTTGTGGCTATTTGTGGG - Intergenic
917543813 1:175941374-175941396 ATGTTCATGAGCTATTTTGGGGG - Intergenic
917944218 1:179952992-179953014 ATGTGCTTGGGGAATTTAGGAGG + Intergenic
919260271 1:195183653-195183675 ATTTTCTTTTGCTATTTTGGGGG + Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
920512201 1:206559620-206559642 ATCTTCCTGTGTCATTTTGCTGG + Intronic
922170582 1:223151132-223151154 ATGTTCTGGTGGCGTGTTGGAGG + Intergenic
922252355 1:223861380-223861402 TTGTTGTTGTTGTATTTTGGGGG + Intergenic
922762793 1:228142828-228142850 AGGGTCTTGTGGTAGTTTGGTGG + Intronic
923087819 1:230714476-230714498 ATGTCCCTGTGGCCTCTTGGGGG - Intergenic
923117344 1:230955184-230955206 ATGTTTTTCAGGGATTTTGGCGG - Intronic
924422109 1:243919150-243919172 AAGTTCTTATGGCATATTTGTGG + Intergenic
1062913859 10:1232397-1232419 ATGTGCTTGTGGCATGTGTGTGG + Intronic
1063341733 10:5271629-5271651 ATATTTTTGTGTCATTTTGTGGG - Intergenic
1063771879 10:9213438-9213460 ATCTTCCTGTGTCATTTTTGAGG - Intergenic
1064222950 10:13456916-13456938 ATGTTCTTGTGGGTATTTGAAGG - Intronic
1067732499 10:48822115-48822137 TTCTTCCTGTGGCTTTTTGGAGG - Intronic
1068500720 10:57837984-57838006 ATTTTCTTGTGGCATTTAATGGG - Intergenic
1068816164 10:61316070-61316092 AGGATCATGTGACATTTTGGAGG - Intergenic
1068948053 10:62749234-62749256 ATGTTCTTTTGAAATTTTAGAGG - Intergenic
1070452962 10:76580341-76580363 AGGTTTGGGTGGCATTTTGGTGG + Intergenic
1070652922 10:78251127-78251149 ATGTTGCTTGGGCATTTTGGGGG + Intergenic
1071002912 10:80851277-80851299 CTGTTCATTTGGCATTTTGCAGG + Intergenic
1071696134 10:87873500-87873522 ATTTTCTGGAGACATTTTGGTGG + Intronic
1078058579 11:8029157-8029179 ATCTTCTTGTGGCTTTTTTCTGG + Intronic
1078182024 11:9019955-9019977 ATGATCGTGTGGCATTCAGGGGG + Intergenic
1078983000 11:16559960-16559982 ATTTTATTTTGCCATTTTGGGGG + Intronic
1082722767 11:56698645-56698667 ATGTTCTAGATGCATTTTGAAGG + Intergenic
1083588022 11:63874474-63874496 ATGTTCTTTGGGTTTTTTGGGGG - Intronic
1083958411 11:66000067-66000089 ATGTTCTTGCGGTATTTGGAGGG + Exonic
1085653336 11:78288779-78288801 ACATTCTTGTGGGATTTTGATGG - Intronic
1085816546 11:79743197-79743219 ATTTTCTTATGGCATTTCAGTGG + Intergenic
1086139178 11:83475309-83475331 ATGTCTTTGTGGCACTTTGCGGG + Intronic
1087930559 11:103973032-103973054 TTGCTCTTGTGGAATTTTAGGGG + Intronic
1090997030 11:131876052-131876074 ATTTTCTTGTGGCATTTGAAGGG + Intronic
1091184967 11:133638724-133638746 GTGTTCAGGTGGCATCTTGGAGG - Intergenic
1091629357 12:2147770-2147792 ATGTTTTGGGGGGATTTTGGGGG + Intronic
1092055369 12:5504438-5504460 TGGTTCTAGTGGCCTTTTGGGGG - Intronic
1093314881 12:17636906-17636928 ATGTCCTTGTGTTATTTTGTGGG + Intergenic
1093352398 12:18119735-18119757 ATGTTATTTTGACAATTTGGTGG + Intronic
1093786099 12:23193641-23193663 ATGTTCTGGTGGCAATGTGGAGG - Intergenic
1095987405 12:48008609-48008631 GTTTTCCTTTGGCATTTTGGGGG + Intergenic
1100551066 12:95646570-95646592 ATGTTCTTGTGTCTTTTTCTGGG - Intergenic
1100802618 12:98249387-98249409 TTGTATTTGTGGTATTTTGGGGG - Intergenic
1101414632 12:104498489-104498511 TTGTTCTTCTGGCTTTTTAGTGG - Intronic
1103858077 12:123988447-123988469 ATTTTCTTCTGCCATCTTGGAGG + Intronic
1106091800 13:26602433-26602455 GTATTCTTGTGGCATGATGGTGG + Intronic
1107171739 13:37350522-37350544 ATGTTCTTGAGGCATTTAAAGGG - Intergenic
1107585666 13:41845493-41845515 ATGTGCATGTGTCTTTTTGGTGG - Intronic
1108329201 13:49368148-49368170 ATGTTCTTGTGACATTTCACTGG - Intronic
1108463792 13:50694358-50694380 ATGGGCTGGTGGCAATTTGGAGG - Intronic
1108696346 13:52905801-52905823 ATTTTATTGTGGGGTTTTGGTGG + Intergenic
1109503898 13:63273862-63273884 ATGGTCCTGTGGAAATTTGGGGG - Intergenic
1109825506 13:67715703-67715725 ATATTCTTGCTGAATTTTGGAGG - Intergenic
1110404524 13:75134787-75134809 ATGTTTTTGTGTTAATTTGGTGG + Intergenic
1112831784 13:103461569-103461591 ATGTTATTGTATCATTTTAGTGG + Intergenic
1113405128 13:110031814-110031836 AAATTCTAGTGGCATTTTGGTGG - Intergenic
1113571038 13:111358158-111358180 ATGTGCTTGTGGTATTGTGTGGG + Intergenic
1114475802 14:22993913-22993935 ATGTTCTTGTGGCAGACTGTGGG - Intronic
1115077364 14:29408194-29408216 CCGTTCTAGGGGCATTTTGGTGG - Intergenic
1118369448 14:65125018-65125040 ATGTTGTAGTGGCATTTTGGGGG + Intergenic
1120045626 14:79802474-79802496 ATGTAACTGTGGCCTTTTGGAGG + Intronic
1121094192 14:91204608-91204630 ATGTGCTTGTTGCCTTTGGGAGG - Intronic
1121972231 14:98368836-98368858 ATGTTGTTGTATCTTTTTGGGGG - Intergenic
1123827310 15:24095225-24095247 ATGTGCTTGTGTCTTTTTGTTGG - Intergenic
1123861339 15:24470552-24470574 ATGTTCTTGTGTCTTTTTGTTGG - Intergenic
1124162276 15:27283265-27283287 ATTTTCTTCTGGTATTTTGATGG + Intronic
1124387942 15:29225442-29225464 AAGATCTTGTTGCATTTTGGTGG + Intronic
1124867817 15:33510630-33510652 ATTTTCTCGTGGAATTTTAGGGG + Intronic
1126123576 15:45274945-45274967 ATGTTCTTGTGGCATTTTGGTGG + Intronic
1126450715 15:48805463-48805485 ATCATCTTGTGTCATTTTGAAGG - Intronic
1130422229 15:83758967-83758989 TTTTTCTTGTGGGATTTTGTAGG + Intronic
1133005271 16:2877359-2877381 CTGGTCTTTTAGCATTTTGGAGG - Intergenic
1135636806 16:24084646-24084668 AATTTCTGGGGGCATTTTGGAGG - Intronic
1137939864 16:52673550-52673572 CTGTAATTGTAGCATTTTGGGGG - Intergenic
1140626834 16:76804339-76804361 ATGATCTGGTGAAATTTTGGGGG - Intergenic
1141688256 16:85582429-85582451 GTGTTCTTGGGGCCTTTTTGGGG + Intergenic
1143002306 17:3802131-3802153 TTGTTCTAGTGGCATTTTAAGGG - Intergenic
1144334577 17:14257261-14257283 ATGTCTTTTAGGCATTTTGGCGG - Intergenic
1144936351 17:18902105-18902127 ATGTTCTTCTGGTATTTAGTGGG - Intronic
1146364289 17:32207108-32207130 ATGATTTTGTTGCATTTTTGTGG - Intronic
1149534693 17:57423819-57423841 ATGTCTTTGTGGCATTTTGGTGG - Intronic
1150542217 17:66113823-66113845 ATGTTCTTGAGTCTATTTGGGGG + Intronic
1153428661 18:4992128-4992150 AAGATCCTGTGGCATTTTGGGGG - Intergenic
1153446700 18:5180756-5180778 ATTTTATTTTTGCATTTTGGGGG - Intronic
1153774638 18:8441800-8441822 ATCTTCCTGTGTCATTGTGGTGG + Intergenic
1155978280 18:32155229-32155251 AGTTTCTTGTGGCATTTTTCTGG - Intronic
1156103247 18:33624438-33624460 TTGTTGTTGTTGTATTTTGGTGG + Intronic
1157378383 18:47188011-47188033 TTCTTATTGTGGCATTTGGGAGG + Intergenic
1159607011 18:70485297-70485319 ATGTTAGTGAGGTATTTTGGGGG + Intergenic
1161168787 19:2802633-2802655 AAGTTCCTGGTGCATTTTGGAGG + Intronic
1164067051 19:21724200-21724222 ATTTTCTTTTAGCATTTTTGAGG + Exonic
1167530123 19:50010534-50010556 ATGTTCAGCTTGCATTTTGGGGG + Intronic
1202637234 1_KI270706v1_random:52931-52953 ATGTTCATGTGGAATTGTAGTGG - Intergenic
925438355 2:3861601-3861623 TGGTTCTTGTAGCATTGTGGTGG + Intergenic
925438364 2:3861858-3861880 TGGTTCTTGTAGCATTGTGGTGG + Intergenic
925438373 2:3862124-3862146 TGGTTCTTGTAGCATTGTGGTGG + Intergenic
925763524 2:7209272-7209294 ATGTTCATCTGGCATGCTGGAGG + Intergenic
926597302 2:14805240-14805262 TAGTCCTTGGGGCATTTTGGAGG + Intergenic
930148168 2:48029088-48029110 ATGCTGTTTTGGCAATTTGGTGG - Intergenic
931077708 2:58735140-58735162 TTGTTTTTATGGCAGTTTGGAGG + Intergenic
934845187 2:97657838-97657860 ATATTCTGTTGGCTTTTTGGTGG - Intronic
936382405 2:111998072-111998094 ATGTTCTAGTAGCATTCTGAAGG - Intronic
937950524 2:127383842-127383864 ATGTTCTTCTAGCATTTTTTTGG + Intronic
938940611 2:136166646-136166668 ATGTTATTATCACATTTTGGGGG - Intergenic
940191811 2:151048756-151048778 ATGAACTTCTGACATTTTGGAGG - Exonic
942886492 2:180931135-180931157 ATGTTCATGTGTCCTTGTGGTGG + Intergenic
943080447 2:183253163-183253185 ATGTTTTGGGGGCATTCTGGGGG - Intergenic
944256833 2:197631671-197631693 ATGTTCTAGTCTCCTTTTGGTGG + Intronic
944284023 2:197927456-197927478 ATGTTCTTCTATCATTTTGAGGG + Intronic
944669314 2:201982013-201982035 GTGTTCTGGTGACTTTTTGGAGG - Intergenic
944850137 2:203710679-203710701 ATTTTCTTCTGGGATGTTGGTGG - Intronic
947678088 2:232003321-232003343 AGTTTATTGTGTCATTTTGGTGG + Intronic
1168944579 20:1741982-1742004 ATCTTCTTCTGACATGTTGGAGG - Intergenic
1169736691 20:8845199-8845221 AGGGTGTTGTGGCATTTTGGAGG + Intronic
1169891359 20:10456003-10456025 TTGTACTTGTGGCATTATGTTGG - Intronic
1171046788 20:21816215-21816237 GTGTCCTTGTGGCATTTTGATGG + Intergenic
1172993987 20:39056491-39056513 GTGTTTGTGTGACATTTTGGTGG + Intergenic
1173651054 20:44664440-44664462 CAGTGCTTCTGGCATTTTGGGGG + Intergenic
1174208636 20:48859387-48859409 ATCTTCATGGGGCATTTTGTGGG - Intergenic
1176843582 21:13859535-13859557 ATATTCATGTGGAATTTTAGGGG - Intergenic
1176958144 21:15129722-15129744 ATGTGATTGGGGCATATTGGGGG + Intergenic
1177592568 21:23190435-23190457 TTCATCTTGTGTCATTTTGGAGG - Intergenic
1182726901 22:32454696-32454718 ATTTTTTTCTGGCATTTTAGAGG - Intronic
949151773 3:777505-777527 ATTTCTTTGTGGCATTTTGAAGG + Intergenic
949298926 3:2560504-2560526 ATGTTCCTTTTGCATTATGGTGG + Intronic
952464049 3:33562275-33562297 AAGTTCTTGGGGGATTATGGGGG - Intronic
952685596 3:36144468-36144490 ATTTTTTTGTGGCATTTTATAGG - Intergenic
956019372 3:64917058-64917080 ATGTCCTTTTGGCTTTATGGAGG - Intergenic
957502418 3:81074359-81074381 ATGTTTTTGTGCTTTTTTGGGGG - Intergenic
957744787 3:84325590-84325612 ATGTTCTGTTGGAATTTTTGAGG + Intergenic
957752924 3:84446244-84446266 ATGTACTTTTGACGTTTTGGTGG - Intergenic
957990342 3:87619062-87619084 TTATTCTCGTGGCATTTAGGGGG - Intergenic
958023597 3:88025544-88025566 ATGGTCTTGTTGCATTTTCTTGG - Intergenic
959133759 3:102391338-102391360 ACATTGTTGTGGCAATTTGGAGG - Intronic
960192295 3:114721445-114721467 ATGTTCTAGAGACATTGTGGAGG + Intronic
960626137 3:119684064-119684086 TGGTGCTTGTGGCATTTTGCAGG - Intergenic
961266638 3:125648256-125648278 ATGTTCATGTGGCTGTTTGAGGG - Intergenic
964252459 3:154734478-154734500 ATGCTCTAGTTGCATTTTTGGGG - Intergenic
964294723 3:155220850-155220872 ATATTCTTCTAGGATTTTGGGGG - Intergenic
964829708 3:160870307-160870329 ATACTCTTGGGGCATTTTGGAGG - Intronic
965305995 3:167063845-167063867 ATGTTCTTGGGTCATGTTGTTGG - Intergenic
966336739 3:178876491-178876513 ATTTTCTTGAAGCATTTTGGGGG - Intergenic
967869338 3:194217186-194217208 ATTTACTTGTAGTATTTTGGAGG + Intergenic
968605007 4:1531193-1531215 CTGTTGGTGTGTCATTTTGGAGG + Intergenic
968605013 4:1531222-1531244 CTGTTGGTGTGTCATTTTGGAGG + Intergenic
969190007 4:5510483-5510505 ATGTTCTTTGCCCATTTTGGGGG - Intergenic
969548634 4:7849033-7849055 AGATTCTTGTGTCATTTGGGTGG - Intronic
969599203 4:8166117-8166139 ATGTTCTCATGGTATTGTGGGGG - Intergenic
971788735 4:31139478-31139500 ATTTTTTTGTGGCATTATAGAGG - Intronic
975075218 4:70198598-70198620 TTGCTCTTGAGGCATTTTGAAGG - Exonic
975501777 4:75094484-75094506 GTTTTCTTGTAGCATTTTGAGGG + Intergenic
976819904 4:89194085-89194107 ATGTTTTATTGTCATTTTGGTGG - Intergenic
977353058 4:95912698-95912720 TTGTTCTTGGGGCATCCTGGGGG + Intergenic
978162292 4:105563247-105563269 ATTTTCTTTTGGCATTTCAGAGG - Intronic
978262998 4:106784808-106784830 ATGTCTTTGTGTGATTTTGGTGG + Intergenic
979489107 4:121304692-121304714 ATGTTTTTGTGTCATTTTAGAGG - Intergenic
980211816 4:129798387-129798409 ATTTTTGTGTGACATTTTGGAGG + Intergenic
980227041 4:129999537-129999559 TTGTAGTTGTGCCATTTTGGTGG - Intergenic
981449180 4:144876104-144876126 ATGTTCTTGTGCACTATTGGTGG + Intergenic
983550294 4:169010464-169010486 ATGTACTTGTGGCACTGAGGGGG + Intergenic
984308289 4:178022972-178022994 ATTTTTTTCTGGAATTTTGGGGG + Intergenic
984556644 4:181221940-181221962 CTGTAGTTGTGTCATTTTGGTGG + Intergenic
985365570 4:189228188-189228210 ATTTTCTTCTCCCATTTTGGAGG + Intergenic
985844735 5:2335814-2335836 ATGTGCTTGTGGACATTTGGTGG + Intergenic
987391870 5:17384177-17384199 AAGATCTAGTGGTATTTTGGAGG + Intergenic
987838580 5:23192976-23192998 ATATTATTTTGACATTTTGGAGG + Intergenic
988365365 5:30291266-30291288 ATGTTATTGTGTCATTTTGCAGG + Intergenic
989883256 5:46827937-46827959 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989890401 5:46968567-46968589 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989897343 5:47108454-47108476 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989897565 5:47112542-47112564 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989897788 5:47116631-47116653 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898309 5:47126344-47126366 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898527 5:47130434-47130456 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898745 5:47134523-47134545 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898965 5:47138612-47138634 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989899191 5:47142700-47142722 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989899408 5:47146618-47146640 ATGTGCTTGTGGATATTTGGAGG + Intergenic
994456967 5:100022298-100022320 AAGTTTTAGTGACATTTTGGTGG - Intergenic
995197518 5:109388790-109388812 ATGTTTTTAGGGCATTTTGGAGG - Intronic
995386141 5:111591640-111591662 AAGTACTTGTGTCTTTTTGGTGG - Intergenic
997781289 5:136661446-136661468 ATGTTCGTGTGGAATTTTCACGG + Intergenic
998008669 5:138675386-138675408 ATTTTCTTTTCGCATTTTGATGG + Intronic
998865218 5:146492392-146492414 AAGTTCTTCTGTCATTTTGTAGG + Intronic
998899685 5:146839565-146839587 ATGTTTTTGTGTCATCTGGGAGG + Intronic
999939806 5:156529980-156530002 ATGCACTTGTTGCATATTGGAGG + Intronic
1002777153 6:338116-338138 ATGCTCTTGTGTGATTTTTGGGG + Intronic
1004196052 6:13506387-13506409 TTGTTGTTGTTGTATTTTGGAGG + Intergenic
1004779256 6:18889036-18889058 ATTTTCTTGTGGTATTATAGTGG + Intergenic
1004966853 6:20861744-20861766 TTGTTCTTGTGGGATGTTGCTGG + Intronic
1005946124 6:30597186-30597208 AGGTTCTTGTGGCTTGTTGCAGG + Intergenic
1006487424 6:34354907-34354929 TTGTTCTAGTAGCTTTTTGGTGG + Intronic
1008484417 6:52019895-52019917 ATGTGCTTTTGCTATTTTGGAGG - Intronic
1010271850 6:73924505-73924527 ATTTAATTGTTGCATTTTGGGGG - Intergenic
1011504264 6:88023733-88023755 CTGTTCTTATGGAAGTTTGGCGG - Intergenic
1012245580 6:96922796-96922818 ATGTTTGTGTTGAATTTTGGTGG + Intergenic
1012497334 6:99848412-99848434 ATGTTGTTGTATGATTTTGGAGG - Intergenic
1014529777 6:122545167-122545189 ATGTGCATGTGTCTTTTTGGTGG - Intronic
1014746165 6:125203354-125203376 GTGTTCTTGTGACTTTTTGTCGG + Intronic
1015865883 6:137725920-137725942 ATTTTCTTGTGCAATTTTGGGGG + Intergenic
1016124468 6:140383961-140383983 GTGTTTTTGTGGGATTTTGAAGG + Intergenic
1016489366 6:144580198-144580220 AAGTTCTGGTGGCATGGTGGTGG + Intronic
1016949679 6:149567057-149567079 ATGTTTTTGTCGGATGTTGGAGG + Intronic
1018097810 6:160407516-160407538 AGCTTCTTGAGGCATTTTTGAGG + Intronic
1018513197 6:164549194-164549216 ATGTTCCTGTGTTAGTTTGGTGG + Intergenic
1022599181 7:31740251-31740273 TTTTTCTTGTGTCATGTTGGAGG - Intergenic
1022890496 7:34692399-34692421 ATGTTCTTGTGTATTTTTGAAGG - Intronic
1022915370 7:34944438-34944460 ATTCTTTTGTGGGATTTTGGGGG - Intronic
1023153596 7:37225475-37225497 ATGTTCTTGTTGCATTCTTAAGG + Intronic
1028728259 7:94114297-94114319 ATGCTCTTCTGACATTTTTGAGG - Intergenic
1030170806 7:106600964-106600986 ATGTTCTTGTGCCTTTTGAGGGG + Intergenic
1031273331 7:119683983-119684005 ATGTTTCTGCTGCATTTTGGAGG + Intergenic
1038385972 8:27145482-27145504 ATGTTCTTACGGCATTTTTCAGG - Intergenic
1039678277 8:39697256-39697278 ATGTTTTTGTGGGATTTTTAGGG + Intronic
1040393411 8:46970536-46970558 ATTTTCTTCTCCCATTTTGGAGG - Intergenic
1041157544 8:55004043-55004065 ATATTCTTGTGCCATTTTTTGGG - Intergenic
1043381856 8:79710888-79710910 ATGTTGTTGTGGGGTTTTGAGGG - Intergenic
1043861496 8:85322319-85322341 ATGTTCTTGTGACATCTAGATGG + Intergenic
1043876034 8:85487426-85487448 CAGTTCTAGTGGCTTTTTGGAGG + Intergenic
1043962703 8:86435344-86435366 ATCTTCCTGTGGTATTTTGTTGG + Intronic
1044158852 8:88887277-88887299 ATGATGTTGTTGGATTTTGGAGG + Intergenic
1045452076 8:102337166-102337188 GTTTTCTTGTGAAATTTTGGAGG + Intronic
1046466116 8:114605421-114605443 ATCTACTTGAGGCACTTTGGTGG + Intergenic
1047559077 8:125966787-125966809 CTGTTCTTGTTGCATCTTGAGGG + Intergenic
1049732034 8:144183423-144183445 TTCTGCTTGTGGCATTATGGTGG + Intronic
1050154133 9:2647910-2647932 GTTTTCTTCTGGCTTTTTGGAGG + Intronic
1050166193 9:2767500-2767522 ATGTTTTGCTGGCAATTTGGAGG - Intronic
1050954105 9:11633332-11633354 ATGTTCTTGTGACATGTTAGAGG - Intergenic
1051952825 9:22657861-22657883 AATTTCTTGTGCAATTTTGGAGG + Intergenic
1053115497 9:35498083-35498105 ATGTTTTTGTGGCATCTTTAGGG + Intronic
1054979533 9:71188927-71188949 ATATTCTTGTGATATTTTGTGGG + Intronic
1055335154 9:75226214-75226236 AAGTTCTAGGGGCTTTTTGGAGG + Intergenic
1057397290 9:94691483-94691505 ATGTTCTCCTGCCATTTTTGAGG + Intergenic
1058057043 9:100459031-100459053 TTGTTTTTGTGGAATTTTGTGGG - Intronic
1058271606 9:102979234-102979256 TTGTTCCTCTGGCATTTTGCTGG + Intergenic
1059410979 9:114132260-114132282 ATATTCTTGGGGCATTTAAGGGG - Intergenic
1060462100 9:123865890-123865912 ATATTTTGGGGGCATTTTGGGGG + Intronic
1186142475 X:6590550-6590572 GTGTTTTAGTGGCCTTTTGGAGG - Intergenic
1186437946 X:9559369-9559391 ATGGTGCTGTGGCTTTTTGGAGG + Intronic
1187213946 X:17256463-17256485 GTCTTCTTGTGGCTTTATGGGGG - Intergenic
1192919227 X:75688377-75688399 ATGTTTTTGTGGAATCTTTGGGG + Intergenic
1193851790 X:86546212-86546234 ATCTGCTGGTGGAATTTTGGTGG - Intronic
1194891657 X:99386098-99386120 TTGTTCATGTAGCAATTTGGTGG + Intergenic
1195648205 X:107257079-107257101 ATGCTCTTGTTGCTTTATGGAGG - Intergenic
1195997703 X:110747492-110747514 ATGTGCATATGGCAATTTGGGGG - Intronic
1200323583 X:155215440-155215462 ATGTAGTTGTAGGATTTTGGAGG + Intronic
1200337464 X:155365319-155365341 ATGTTCTTCTGGGAATTTTGTGG + Intergenic
1200349006 X:155475908-155475930 ATGTTCTTCTGGGAATTTTGTGG - Intergenic