ID: 1126125230

View in Genome Browser
Species Human (GRCh38)
Location 15:45289535-45289557
Sequence GAGAATATAGGGATGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126125230_1126125236 26 Left 1126125230 15:45289535-45289557 CCTTTTACCATCCCTATATTCTC No data
Right 1126125236 15:45289584-45289606 GCTACTGTGTTCAAAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126125230 Original CRISPR GAGAATATAGGGATGGTAAA AGG (reversed) Intergenic
No off target data available for this crispr