ID: 1126126768

View in Genome Browser
Species Human (GRCh38)
Location 15:45301098-45301120
Sequence CATTATATTAAGAGATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126126768_1126126771 4 Left 1126126768 15:45301098-45301120 CCTTCCTATCTCTTAATATAATG No data
Right 1126126771 15:45301125-45301147 TCCTGTAGGTCCTGATCCTTAGG No data
1126126768_1126126770 -10 Left 1126126768 15:45301098-45301120 CCTTCCTATCTCTTAATATAATG No data
Right 1126126770 15:45301111-45301133 TAATATAATGTCTTTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126126768 Original CRISPR CATTATATTAAGAGATAGGA AGG (reversed) Intergenic
No off target data available for this crispr