ID: 1126134335

View in Genome Browser
Species Human (GRCh38)
Location 15:45376533-45376555
Sequence AGTCAGAGGGTAGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 337}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126134335 Original CRISPR AGTCAGAGGGTAGCAGCAGC AGG Intronic
900088072 1:908171-908193 AGTCGGAGGGCAGCACAAGCCGG + Intergenic
900707674 1:4090576-4090598 AGGCTCAGGGCAGCAGCAGCTGG - Intergenic
901082721 1:6592694-6592716 AGTCAGGGGGTAGGAGCAGGGGG + Exonic
901275739 1:7989755-7989777 TTTTAGAGGGAAGCAGCAGCAGG + Intergenic
901534360 1:9872725-9872747 TGTCAGAGGGTAGCTCCTGCAGG + Intronic
901536411 1:9885113-9885135 GGTGAGAGGGCAGCAGCAGAGGG + Intronic
901940374 1:12657253-12657275 AGACTGAGGGAAACAGCAGCAGG + Intronic
902491128 1:16781472-16781494 AGTCAGAGGGTTCCAGCAGAGGG + Intronic
904336503 1:29801644-29801666 AGGCAGAGGGGAGGAGCAGCAGG + Intergenic
904345745 1:29867784-29867806 AGTCAGATGGTAGTTGGAGCTGG + Intergenic
904378838 1:30097691-30097713 ACCCAGAGGGCAGCAGCTGCAGG + Intergenic
904649517 1:31994268-31994290 AGCCAGAGGCTAGCAATAGCAGG + Intergenic
904896260 1:33820609-33820631 AGTCACAGGGAGGCACCAGCTGG + Intronic
905105162 1:35559510-35559532 ACTCATAGGGTAACAGCAGCAGG + Intronic
906047985 1:42847105-42847127 AGTCAGAGGGTCGCAGGAGACGG - Intronic
906945717 1:50292553-50292575 AGCCAGTGAGTGGCAGCAGCAGG - Intergenic
908253430 1:62283227-62283249 AGGGAGAGGGGAGCAGGAGCAGG - Intronic
910263520 1:85314399-85314421 AGTCAGAGGATATCAGCACAAGG - Intergenic
910866484 1:91792758-91792780 AGTCAGAGGGTACTAGGAGCTGG + Intronic
913230556 1:116737458-116737480 TGCCAGAGGGTGGCAGCAGCAGG + Intergenic
914419672 1:147517855-147517877 GGGCAGCGGGTTGCAGCAGCTGG + Intergenic
917212444 1:172644376-172644398 TGTCAGAGGGCAGCATCAGGGGG + Intergenic
918389746 1:184046606-184046628 AGTGAGAGAGTAGCACGAGCTGG - Intergenic
920021920 1:202962803-202962825 TGTCAAGTGGTAGCAGCAGCTGG + Intronic
920212358 1:204337377-204337399 AGTAAGAAGGTAGCAGCTACTGG - Intronic
920286188 1:204881542-204881564 AGACAGAAGGCAGCAGCAGAAGG + Intronic
921334482 1:214072637-214072659 AGGCAGAGGGAGGCAGCAGGGGG - Intergenic
923529315 1:234801062-234801084 AGTCAGAGGGTTCCAGCAGAGGG - Intergenic
923611545 1:235500020-235500042 AGAGAGAGGACAGCAGCAGCAGG + Intronic
1062980688 10:1719879-1719901 AGTCAGAAGGTATCAGATGCTGG + Intronic
1063444765 10:6104743-6104765 AGTCAGGTGGTAGCAGAAACAGG - Intronic
1064021699 10:11814313-11814335 GGACAGAGGGGATCAGCAGCAGG - Intergenic
1066480305 10:35789170-35789192 ATCCAGAGGCAAGCAGCAGCGGG - Intergenic
1066632051 10:37467427-37467449 AGTCACAGGGTAGGGGCATCAGG - Intergenic
1067065808 10:43103441-43103463 AGTCAGAGGGTGGGATGAGCTGG + Intronic
1067711849 10:48656317-48656339 AGTCAGAAGGGTGCAGCAGCCGG + Intergenic
1070443156 10:76466251-76466273 GGGCAGAGGGTATGAGCAGCTGG + Intronic
1070496491 10:77028592-77028614 AATCACAGGGTAGCAGTAGCTGG - Intronic
1070530458 10:77332416-77332438 TGGCAGAAGGTGGCAGCAGCTGG - Intronic
1071458645 10:85870682-85870704 AGGTAGAGGGTAGAGGCAGCAGG + Intronic
1071962516 10:90821013-90821035 AGTCACAGAGTAGCAGGAGGTGG + Intronic
1073638886 10:105229730-105229752 GGTCCTAGGGTAGCAGCAGTGGG + Intronic
1074506856 10:114078776-114078798 AGTCAGAGGAGAGCAGAAGTAGG - Intergenic
1074517324 10:114182209-114182231 GGTCACAGGGCAGCAACAGCTGG + Intronic
1078347257 11:10561795-10561817 TGGCAGTGGGTAGCATCAGCTGG + Intronic
1078549522 11:12270535-12270557 ACCCAGAGAGGAGCAGCAGCAGG - Intergenic
1079837418 11:25351254-25351276 AGCCTGAGGGCAGCAGAAGCTGG + Intergenic
1080856368 11:36115197-36115219 AGTCAGACAGTATCTGCAGCTGG - Intronic
1081847577 11:46251894-46251916 AACCAGAGAGGAGCAGCAGCAGG - Intergenic
1083424259 11:62574965-62574987 GGTCAGACGGGAGCAGCTGCAGG + Intronic
1083826461 11:65206730-65206752 AGTCAGAGGGGGACAGCAGAGGG - Intronic
1083986467 11:66219056-66219078 AGTCGGAGGGTAGCATGAGCAGG + Intronic
1084007801 11:66332444-66332466 AGTCAGAGGCAAGAAGCAGAGGG - Exonic
1084266721 11:68008797-68008819 AGGGAGATGGTAGCAGCGGCAGG + Intronic
1084943976 11:72629112-72629134 GGTCAGAGGGAAGAGGCAGCAGG + Intronic
1088916952 11:114234799-114234821 AGGCAGAGGCAAGCAGCATCAGG - Intronic
1089008015 11:115108717-115108739 AGCCAGAGGCTAGCAGGAGCAGG - Intergenic
1089027059 11:115282313-115282335 AGCCATAGGGTAGATGCAGCTGG - Intronic
1089315303 11:117587348-117587370 AGTTAGAAGGTGGCAGCCGCAGG + Intronic
1089678882 11:120108437-120108459 AGTCACAGGGTGGAAGCTGCTGG - Intergenic
1090795156 11:130129086-130129108 AGCCAGTGAGAAGCAGCAGCTGG + Exonic
1091197945 11:133747632-133747654 AGACAGGAGGAAGCAGCAGCAGG + Intergenic
1091812354 12:3409936-3409958 AGGCAGGGTGTAGCAGCAACTGG + Intronic
1092169098 12:6362259-6362281 AGTCAGAGGGGACACGCAGCCGG + Intronic
1093785570 12:23188266-23188288 AGTCAGATGGTAGCAGGGGATGG - Intergenic
1094481414 12:30885353-30885375 AGGCAGGGTGTAGCAGCAACTGG - Intergenic
1095734077 12:45537204-45537226 AGTGAGAGGGTAAAAGCAGAAGG - Intergenic
1096352695 12:50913374-50913396 AGTCAGTTGGTAGCATCTGCAGG - Intergenic
1100654693 12:96629030-96629052 ATTCAGAGGGCAGCAGTGGCTGG + Intronic
1100985515 12:100199251-100199273 GGTCAGAGGGAAGGAGCAGAGGG + Intronic
1101578816 12:106023022-106023044 AGTGAGAGGGAAGCAGAGGCAGG + Intergenic
1101831007 12:108256655-108256677 AGTCAGTGGGTAGAAGGATCTGG + Intergenic
1102634615 12:114312103-114312125 ATTCTGAGGGTAGAAGCAACTGG - Intergenic
1102723223 12:115035673-115035695 ACACAGAGGGTAGCAGCTGGAGG - Intergenic
1102898104 12:116614718-116614740 AATCAGATGGTACCAGCAGACGG + Intergenic
1103316816 12:120062836-120062858 AGTCAGAGGCTGGCAGAGGCAGG - Intronic
1104289626 12:127455784-127455806 AGGCAGAGGGGACCAGGAGCGGG + Intergenic
1104792388 12:131492294-131492316 ACGCAGAGGGCAGCAGCAGCAGG - Intergenic
1105239798 13:18598981-18599003 ATTCAGACTGTAGCTGCAGCAGG - Intergenic
1106428790 13:29659260-29659282 AGCCAGAGGGTAGAAGAGGCTGG - Intergenic
1107122568 13:36811708-36811730 ATCCAGAACGTAGCAGCAGCAGG + Intergenic
1107277063 13:38689261-38689283 AGTGACAGAGTGGCAGCAGCAGG + Exonic
1108699646 13:52932990-52933012 CTCCAGAGGGTAGCAGCAGAGGG - Intergenic
1114051799 14:18925334-18925356 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1114053700 14:18946175-18946197 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1114108857 14:19455750-19455772 ACCCAGAGATTAGCAGCAGCAGG + Intergenic
1114110760 14:19476587-19476609 ACCCAGAGATTAGCAGCAGCAGG + Intergenic
1115537092 14:34383534-34383556 AGGCTGAGGGTGGGAGCAGCAGG - Intronic
1116300487 14:43174872-43174894 AGTCAGTGGGTAGCCACAGCTGG + Intergenic
1118323026 14:64764364-64764386 GCTCAGAAGGGAGCAGCAGCAGG + Intronic
1118484221 14:66198589-66198611 AGGGAAAGGGTAACAGCAGCTGG - Intergenic
1118492400 14:66273822-66273844 AGTCACTGGGGAGCACCAGCAGG + Intergenic
1118551677 14:66957794-66957816 AGTGGGAGGTGAGCAGCAGCGGG + Intronic
1118734185 14:68690348-68690370 AGTCAGAGGGGAGCAGGGGCTGG + Intronic
1118863737 14:69685746-69685768 AGTGAGAGGGTAGAAGTAGTGGG + Intronic
1118974129 14:70662974-70662996 AGGCAGAGGTGACCAGCAGCAGG - Intronic
1119484594 14:74979448-74979470 AATAAGAAGGAAGCAGCAGCAGG + Intergenic
1120372365 14:83652359-83652381 AGGCAGACGGTAGAAGCAGATGG - Intergenic
1121098036 14:91231574-91231596 AGCCAGAGGAAAGCAGCAGATGG + Intergenic
1121849871 14:97211799-97211821 AGACAGAGGGTAGCAGTGGTGGG + Intergenic
1122342803 14:101039274-101039296 AGACAGAAGGTAACAGAAGCAGG - Intergenic
1122437823 14:101711599-101711621 TGCCACAGGGGAGCAGCAGCTGG + Intergenic
1122794486 14:104199225-104199247 AGTGAGAGAACAGCAGCAGCAGG + Intergenic
1122840664 14:104461322-104461344 AGTCAGTGGGGAGGAGCAGGAGG + Intergenic
1123491447 15:20785106-20785128 ATTCAGACTGTAGCTGCAGCAGG + Intergenic
1123547949 15:21354197-21354219 ATTCAGACTGTAGCTGCAGCAGG + Intergenic
1124506015 15:30274490-30274512 GGTGAGAGGGTACCAGCAGAGGG - Intergenic
1124737538 15:32264142-32264164 GGTGAGAGGGTACCAGCAGAGGG + Intergenic
1125274884 15:37979284-37979306 AGCCTGAGGGCAGCAGGAGCAGG + Intergenic
1125275014 15:37980031-37980053 AGTCTGAGGGCAGCGGGAGCTGG + Intergenic
1125610144 15:40964157-40964179 AGGCAGAGGGTGGCAGGAGAAGG + Intergenic
1125623312 15:41083979-41084001 AGTCAGAATGTAGGAGTAGCTGG - Intronic
1126134335 15:45376533-45376555 AGTCAGAGGGTAGCAGCAGCAGG + Intronic
1126180665 15:45782179-45782201 AGTCTGAGGATAACAGCTGCAGG - Intergenic
1126330951 15:47530789-47530811 AGTTAATGAGTAGCAGCAGCAGG - Intronic
1126586727 15:50296168-50296190 AGCCAGAATGTAGCAGCAGATGG - Intronic
1127544406 15:59976774-59976796 ACACAGAGGTTAGCAGTAGCAGG - Intergenic
1129113112 15:73349749-73349771 AGGCAGGAGGTAGCAGCAGTAGG - Intronic
1129155155 15:73712986-73713008 AGCCAGAGGGTAGGAGCTGTAGG - Exonic
1129246096 15:74279936-74279958 AGGGAGAGGGTAGGAGCAGGTGG - Intronic
1129607410 15:77031588-77031610 TGTCAGAGGTTGGCAGAAGCTGG + Intronic
1129789380 15:78330814-78330836 AGTCAGAGGGAGACAGCACCAGG - Intergenic
1131042091 15:89279049-89279071 AGTCAATGAGTGGCAGCAGCAGG - Intronic
1202956279 15_KI270727v1_random:81427-81449 ATTCAGACTGTAGCTGCAGCAGG + Intergenic
1132457003 16:29609-29631 ACTCAGAGGGCAGCAGGAGCAGG - Intergenic
1134448769 16:14350467-14350489 AGGCAGTGAGTAGGAGCAGCAGG - Intergenic
1136228636 16:28874550-28874572 AGTCACAGGGTAGCCGCAGAGGG + Intergenic
1136284096 16:29231158-29231180 AGGCAGAGGGAACCAGCTGCTGG - Intergenic
1137514006 16:49126708-49126730 AGTCATAGCCTAGCAGAAGCAGG - Intergenic
1137815659 16:51395424-51395446 AGGCAGAGAGGAGAAGCAGCTGG + Intergenic
1140615750 16:76661145-76661167 AGACAGTGGGTAGCAGTAGATGG + Intergenic
1140682478 16:77398913-77398935 CGTCATAGGGTAGCTGCTGCAGG + Intronic
1142089128 16:88200666-88200688 AGGCAGAGGGAACCAGCTGCTGG - Intergenic
1142336666 16:89493779-89493801 AGCCAGACGGAAGCAGGAGCAGG + Intronic
1142698998 17:1648514-1648536 AGTCAGAGGGTCGCCTCGGCTGG + Intronic
1142747997 17:1969911-1969933 AGTCAGATGGTGGCAGGGGCTGG + Intronic
1143725170 17:8839586-8839608 AGCCAGCTGGCAGCAGCAGCTGG - Intronic
1143993199 17:10984634-10984656 AGTCAGAGGGGACCTGCAGTTGG + Intergenic
1144761143 17:17708152-17708174 CATCAGAGGGTGGCAGCAGGAGG - Intronic
1145193001 17:20863698-20863720 ACTCAGAGATTAGAAGCAGCAGG + Exonic
1145403415 17:22565702-22565724 ACTCAGAGATTAGAAGCAGCAGG + Intergenic
1146062475 17:29614423-29614445 CCACAGAGGCTAGCAGCAGCTGG - Exonic
1146074897 17:29719103-29719125 AGTCAGAGAGTTGTGGCAGCTGG - Intronic
1148326402 17:46785769-46785791 AGTCAGAGGGAAGAGGCTGCGGG + Intronic
1149435302 17:56628868-56628890 CTTCAGAGGGTGTCAGCAGCAGG - Intergenic
1149546533 17:57508055-57508077 CTTCAGAGCGCAGCAGCAGCAGG + Intronic
1150209016 17:63431397-63431419 AGTAGGAGGTGAGCAGCAGCGGG + Intergenic
1151915511 17:77115023-77115045 GGTCAGAGGCAGGCAGCAGCAGG - Intronic
1152383102 17:79952347-79952369 GGGCAGAGGGTAGCAGCTGCCGG - Intronic
1154300470 18:13186870-13186892 GGTCAGAGGCAAGCAGCACCTGG + Intergenic
1154449032 18:14459793-14459815 ATTCAGACTGTAGCTGCAGCAGG + Intergenic
1155216529 18:23648106-23648128 AGTCAGAGGGTAGGAGGAGAGGG - Intronic
1155932767 18:31724362-31724384 AGTCAGAGGTCAGCTGGAGCGGG - Intergenic
1155988438 18:32254920-32254942 ACTCAGTGGGTAGCAGTGGCTGG - Intronic
1156651686 18:39233653-39233675 TGGCAGAGGGGAGAAGCAGCTGG - Intergenic
1158732857 18:60044916-60044938 GGACACAGGGGAGCAGCAGCAGG + Intergenic
1158945679 18:62445141-62445163 GGTCAGAGGGTAACAGGATCAGG - Intergenic
1159122446 18:64186294-64186316 ATTCAGAGGGCTGGAGCAGCAGG + Intergenic
1159990397 18:74899964-74899986 AGACAGAGGGTGGCAGCTGAAGG + Intronic
1160735766 19:661749-661771 GGTCAAAGCGTAGCAACAGCCGG + Intronic
1162314848 19:9932511-9932533 ACTCAGAGAGTGGCAGCAGGGGG + Intronic
1163345212 19:16736947-16736969 AGTCAAATGGAAGCAGCAGGTGG + Intronic
1163410492 19:17150876-17150898 AGTCTGAGGGTACCAGCACAGGG - Intronic
1164776082 19:30854803-30854825 AGTCAGAGTCTACCTGCAGCTGG - Intergenic
1164881031 19:31732969-31732991 AGGCACAGGGTAGGAGCTGCCGG - Intergenic
1165393459 19:35551188-35551210 GGTCAGATGTCAGCAGCAGCAGG + Intronic
1165755157 19:38288620-38288642 ACTCGGTGGGTAGCAGCTGCCGG - Intronic
1167399076 19:49252857-49252879 AGACAGAGGTGAGCATCAGCAGG + Intergenic
1168047585 19:53805095-53805117 AGTCAGAGGAGGGCAGAAGCAGG + Intronic
1168403755 19:56100325-56100347 AGGCAGAGAGAACCAGCAGCAGG - Intronic
925216132 2:2097210-2097232 AATCAGAGGGGAGAAGCAGAGGG - Intronic
925362386 2:3288638-3288660 CATCAGAGGGTGGCAGCTGCTGG + Intronic
925684649 2:6458686-6458708 AGACCAAGAGTAGCAGCAGCAGG + Intergenic
925970745 2:9105045-9105067 AGACGGACGGGAGCAGCAGCCGG + Intergenic
927509879 2:23637747-23637769 GGTCAGAGGGGCTCAGCAGCAGG + Intronic
927869121 2:26612670-26612692 AGACAGAGAGCAGGAGCAGCTGG + Intronic
927883078 2:26702372-26702394 TGTCAGAGGAGAGGAGCAGCAGG + Intronic
928377123 2:30784354-30784376 AGTCATAAGGTAGCAGCCTCAGG - Intronic
928606585 2:32948762-32948784 ATCCAGAGGGTTGCAGAAGCTGG + Intronic
929087360 2:38181637-38181659 AGGGGGAGGGTAGGAGCAGCTGG + Intergenic
929087487 2:38182833-38182855 TGTCAGCTAGTAGCAGCAGCAGG + Intergenic
930049730 2:47205733-47205755 AGCCAGACCGGAGCAGCAGCAGG + Intergenic
930272609 2:49274425-49274447 TGTCTGAGGGTAGCAGAAGATGG - Intergenic
931321002 2:61175040-61175062 AGTGAAAGGGTGGAAGCAGCTGG + Intergenic
933484062 2:82896363-82896385 AGCCTGAGGGCAGCAGGAGCAGG - Intergenic
933905758 2:86890984-86891006 AGTCAGATGGGAGAAGCAGCAGG + Intergenic
934034434 2:88077289-88077311 AGTGAGAGGGGACCAGCTGCTGG + Intronic
935766599 2:106374146-106374168 GGTCAGATGGGAGAAGCAGCAGG + Intergenic
935944900 2:108276932-108276954 AGACAGAGGATGGCAGAAGCTGG + Intergenic
936351273 2:111714472-111714494 AGCCAGAGGGACGCTGCAGCTGG + Intergenic
936366403 2:111860670-111860692 GGTCAGATGGGAGAAGCAGCAGG - Intronic
938471664 2:131568677-131568699 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
938628531 2:133138878-133138900 ATGCAGGGGGTAGGAGCAGCAGG - Intronic
938968205 2:136407046-136407068 TGTCTGGGGGTAGCTGCAGCAGG - Intergenic
939521541 2:143237557-143237579 AGTCAGATGGAAGCACCAGTAGG - Intronic
939646234 2:144702325-144702347 AGTCATAGGGTAGCTCCAGATGG - Intergenic
942043068 2:172083672-172083694 ATTCTGCGGGCAGCAGCAGCTGG + Intergenic
942924031 2:181411239-181411261 AGACAGAAGGCAGCTGCAGCTGG - Intergenic
943969566 2:194386175-194386197 TGTCAGAGAGGAGAAGCAGCTGG + Intergenic
944191631 2:197010024-197010046 AGTGTGAGGGGAGCAGGAGCAGG + Intronic
946050403 2:216857488-216857510 ACTCAGAAGGGAGCATCAGCTGG - Intergenic
946427934 2:219609261-219609283 AGCCAGAGGGAAGTGGCAGCAGG + Intronic
947618592 2:231574340-231574362 AGACAGAGAGTGGCTGCAGCAGG + Intergenic
948506944 2:238434919-238434941 AGTCAGAGCCTAGGCGCAGCTGG + Intronic
948808302 2:240462405-240462427 AGTCATCAGGCAGCAGCAGCTGG - Exonic
1168832130 20:851823-851845 AGCCAGAGGTTAGCACCAGTGGG - Intronic
1168849393 20:966150-966172 AGTCAGGGGCCATCAGCAGCTGG + Intronic
1169161076 20:3378950-3378972 AGTCAAAGGGTAGCAAAAGGTGG + Intronic
1169298016 20:4416654-4416676 AGTCAGAGAGCTGCAGCACCAGG - Intergenic
1169876027 20:10297780-10297802 AGCCAGAGGGTAAGAGGAGCTGG + Intronic
1170911211 20:20571257-20571279 AGTCAGTGGGGAGAAGAAGCAGG + Intronic
1171935817 20:31274187-31274209 GGGCAGAGAGGAGCAGCAGCAGG - Intergenic
1172189782 20:33054948-33054970 AGCCAGTGGGAAGCAGCTGCTGG + Intergenic
1175969365 20:62676038-62676060 AGTCAGACGCCAGGAGCAGCTGG + Intronic
1176447180 21:6830709-6830731 ATTCAGACTGTAGCTGCAGCAGG - Intergenic
1176825350 21:13695735-13695757 ATTCAGACTGTAGCTGCAGCAGG - Intergenic
1180224990 21:46386931-46386953 ACACAGATGGGAGCAGCAGCAGG - Intronic
1180470272 22:15647713-15647735 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1180472169 22:15668556-15668578 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1181021427 22:20105529-20105551 AGGCATAGGGAAGCTGCAGCAGG - Intronic
1181171934 22:21014842-21014864 GGCCTGAGGGCAGCAGCAGCAGG - Intronic
1181298720 22:21863662-21863684 TGTAAGAGGGGAGCAGGAGCTGG - Intronic
1181781578 22:25197652-25197674 AGCCAGAGGGTGGCAGGAGGAGG - Intergenic
1182355136 22:29719547-29719569 GGTCACAGGGCAGGAGCAGCAGG - Intergenic
1182718181 22:32376693-32376715 AGTGAGAGAGGAGCAGCAGGAGG - Intronic
1184451045 22:44583034-44583056 AGTGAGCGGGTAGCAGCGGAAGG - Intergenic
1184497878 22:44853180-44853202 AGAGAGAGAGTGGCAGCAGCTGG + Intronic
950040275 3:9915561-9915583 AGTAAGCGAGCAGCAGCAGCGGG - Exonic
950133310 3:10562503-10562525 ACTCAGTGGGCAACAGCAGCTGG + Intronic
951319316 3:21225867-21225889 CGGCAGAGAGTAGAAGCAGCCGG + Intergenic
951753451 3:26062358-26062380 AGTCAGAGGAGTGCAGCAGCAGG - Intergenic
952251791 3:31663149-31663171 AGTCAGGGGTTACCAGCACCTGG + Intronic
953154498 3:40356810-40356832 GGCCAGAGGGGAGCACCAGCTGG + Intergenic
954792463 3:53143358-53143380 GCCCAGAGGGTAGCACCAGCAGG - Intergenic
956095563 3:65712408-65712430 AGCCAGATGGTAGCTGCAGCTGG - Intronic
959129558 3:102337391-102337413 AGGCAGAGGGTAGCAGCTCAGGG - Intronic
960270984 3:115674416-115674438 ATTCAGAGGATAGGAACAGCAGG - Intronic
960997494 3:123349687-123349709 AGTCTGGGGGTGGCAGGAGCGGG - Intronic
961722252 3:128904664-128904686 AGGCAGCGGGGAGCAGCAGTAGG + Intronic
962383455 3:134914754-134914776 ACTCAGGGACTAGCAGCAGCAGG + Intronic
963388328 3:144625386-144625408 AGGCAGAAGGTTACAGCAGCAGG - Intergenic
964799375 3:160537939-160537961 AGACAGAGGGTAAGAGCAGGAGG - Intronic
965243569 3:166234687-166234709 TGTCAGGGGATAACAGCAGCTGG - Intergenic
965890913 3:173512508-173512530 CGGCAGAGGTTAGAAGCAGCTGG - Intronic
967089362 3:186122128-186122150 AGGCAGAAAGCAGCAGCAGCAGG - Intronic
967134792 3:186504155-186504177 AGTCAGAGGGTAGAAGTCACAGG + Intergenic
968620831 4:1602820-1602842 GGTCTGAGGGCAGCAGGAGCCGG + Intergenic
969036209 4:4255943-4255965 ACTCCCAGGGGAGCAGCAGCAGG + Intergenic
970407256 4:15775666-15775688 AGTTTGAAGGTAGCAGCAGCAGG - Intergenic
970872327 4:20830164-20830186 AGTCAGTAAGTAGCAGCATCAGG + Intronic
972847872 4:43011339-43011361 GGTCAGAGGGAAGCTGGAGCAGG + Intronic
975888240 4:78991807-78991829 AGTGAGAGAGCAGCAGCAGGAGG + Intergenic
977587219 4:98787048-98787070 AGACAGAGGGCAGCAGTACCAGG + Intergenic
977587242 4:98787240-98787262 AGGAAGAGGCAAGCAGCAGCTGG + Intergenic
978248986 4:106608141-106608163 AGTAATTGGGTACCAGCAGCTGG + Intergenic
978750374 4:112239399-112239421 ATGCAGAGGAGAGCAGCAGCAGG - Intronic
979325509 4:119374401-119374423 ATACAGAGGGTAGGAGAAGCTGG - Intergenic
981144822 4:141312065-141312087 AGCTAGCGGGTGGCAGCAGCAGG - Intergenic
983034056 4:162840194-162840216 ACCCAGAGTCTAGCAGCAGCAGG - Intergenic
986787540 5:11128144-11128166 AGTCAGAGAGGTGCAGCAGAAGG + Intronic
986792928 5:11181102-11181124 AGCCAGCGGGTACCAGGAGCAGG + Intronic
987139479 5:14930620-14930642 AGTCAGACGGTAGCTGAGGCAGG + Intergenic
987299542 5:16585258-16585280 AGACAGTGGGGAGGAGCAGCAGG + Intronic
989255102 5:39358077-39358099 AGTCAGATGGTGGCTGCAGCTGG - Intronic
992162323 5:74015463-74015485 GGTCAGAGGGAGGCACCAGCAGG - Intergenic
992364537 5:76078379-76078401 AGTCAGAGGGTTTCAGGAGCTGG + Intergenic
993104394 5:83582679-83582701 AGTTAGTGTGTAGCAGAAGCAGG + Intergenic
995618144 5:113990533-113990555 GGGCAGAGGGTAGCAGAGGCTGG - Intergenic
995840195 5:116436694-116436716 AGGCAGAGGGTAGCAGCTCAGGG - Intergenic
996183225 5:120446256-120446278 AGCCAGAGATTAACAGCAGCTGG + Intergenic
996230842 5:121061457-121061479 ATTCAGAGGTTGGCAGTAGCAGG + Intergenic
998477916 5:142436861-142436883 AGGCAGAGAGTAACAGCAGCTGG - Intergenic
999322469 5:150624155-150624177 AGTCAGGGGATGGCAGCAGGTGG + Intronic
999530858 5:152462136-152462158 AGTCATAGGCTGGGAGCAGCTGG + Intergenic
999696653 5:154193008-154193030 AGAGAGAGGGGAGCAACAGCTGG + Intronic
1001011978 5:168107097-168107119 AGAGAGAGGGTAACAGCATCAGG - Intronic
1001631758 5:173180517-173180539 AGTCAGATGGTAGCTGGTGCTGG - Intergenic
1001959609 5:175872203-175872225 AGTCAGAGGGCGGCGGCAGGGGG + Intronic
1002308075 5:178295973-178295995 GGCCAGAGGGCAGGAGCAGCAGG + Intronic
1002335073 5:178471864-178471886 AGTCAGGGGGTGGAAGGAGCTGG - Intronic
1002603883 5:180370667-180370689 AGTCACAGGCCAGCAGGAGCAGG - Intergenic
1002818640 6:701782-701804 AGTCTTAGGGCAGCAGCCGCTGG + Intergenic
1004318401 6:14612424-14612446 AGTCAGAGGGTAGCAGCCTGAGG + Intergenic
1004331919 6:14729402-14729424 AGTGGGAGGGTGTCAGCAGCCGG + Intergenic
1006449163 6:34096071-34096093 AGGCAGAGGGATGGAGCAGCTGG - Intronic
1006589848 6:35146562-35146584 AATCAGAAGGTGGCAGCAGGGGG + Intronic
1007276535 6:40678406-40678428 AGTCAGTGGCTGGAAGCAGCCGG + Intergenic
1007764763 6:44153997-44154019 ATTCAGAGGGTATCAGAAGCTGG + Intronic
1008107083 6:47450858-47450880 TGGCAGAGGGAATCAGCAGCTGG - Intergenic
1008453785 6:51684767-51684789 AATCAGAAGGTACAAGCAGCTGG + Intronic
1008740112 6:54596541-54596563 AATCAGAGGGTGGCAGCATGAGG - Intergenic
1008960568 6:57261692-57261714 AGCCAATGGGTGGCAGCAGCAGG + Intergenic
1010367268 6:75065809-75065831 AGGCAGTGGGAAGCACCAGCAGG - Intergenic
1010371892 6:75119843-75119865 AGTCAGTGGGAAGTAGCAGTTGG - Intronic
1011626640 6:89288474-89288496 AGTCAGATGGTGGCAGCTGATGG - Intronic
1014215693 6:118750749-118750771 AGTCAGTGGCGTGCAGCAGCTGG + Intergenic
1014286230 6:119502287-119502309 AGTCAGAGAGTAGAAGCACAGGG - Intergenic
1015512490 6:134052397-134052419 AGACGGAGGGCAGCGGCAGCCGG - Exonic
1018226761 6:161636327-161636349 GGCCAGAGGGCAGGAGCAGCGGG + Intronic
1018630686 6:165819481-165819503 AGTCAGAGGGCAGCACGTGCAGG - Intronic
1018709558 6:166488309-166488331 AGTCAGACAGCAGCAGGAGCAGG - Intronic
1019120785 6:169801977-169801999 AGGCAGGGGGTCGCAGCCGCAGG - Intergenic
1019145065 6:169971037-169971059 AGGCACAGGGCAGCAGCAGTGGG + Intergenic
1019547613 7:1586072-1586094 AGGCAGAGGGTAGGAGCTGGAGG - Intergenic
1020093051 7:5352125-5352147 AGTCACAGGGCAGCAGGAGCTGG + Intronic
1020481139 7:8663087-8663109 AGTCAGAGGGTATCAGGATGTGG + Intronic
1021128815 7:16886110-16886132 AGCCAGAGAGTAACAGAAGCAGG + Intergenic
1022443833 7:30454072-30454094 AGTCAGAAGCTAGCAGTGGCTGG + Intronic
1022532287 7:31074546-31074568 TGTCAGCTGGCAGCAGCAGCTGG + Intronic
1022866512 7:34427307-34427329 AGACAGAGGTTGGCTGCAGCAGG - Intergenic
1023664914 7:42513056-42513078 GGTCAAAGGGAAGCAGGAGCTGG - Intergenic
1023760480 7:43461198-43461220 AGTCAGAGGGTGGCCGGGGCTGG + Intronic
1024374852 7:48625471-48625493 ATTCAGTGGTTAGTAGCAGCAGG - Intronic
1029401770 7:100351640-100351662 AGTCAGAAGGTAGCAGGGGCTGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1032096737 7:128942037-128942059 AGCCAGAGGGGAGCCTCAGCAGG - Intronic
1032399815 7:131616955-131616977 AGCCAGAGGGTAGCTGCATGGGG + Intergenic
1032498664 7:132382371-132382393 AGCCTGAAGGCAGCAGCAGCAGG - Intronic
1034375726 7:150642254-150642276 GGGCAGATGGTGGCAGCAGCTGG + Intergenic
1035214571 7:157355613-157355635 AGGCAGTGGGGAGCTGCAGCAGG + Intronic
1036794186 8:11743447-11743469 AGTCTGAGGGGAGCATCTGCAGG + Intronic
1038683056 8:29687875-29687897 AGGCAGATGGCAGCTGCAGCTGG + Intergenic
1039413573 8:37375426-37375448 GGTCAGAGGGCAGCAACATCTGG - Intergenic
1040296354 8:46151084-46151106 AGACAGAGGGGAGAAGCGGCGGG - Intergenic
1040304831 8:46206616-46206638 AGGCAGAGGGGAGAAGCAGTGGG + Intergenic
1040306402 8:46214125-46214147 AGGCAGAGGGTAGAAGCAGGGGG + Intergenic
1040307013 8:46217326-46217348 AGTCACAGAGTGGCATCAGCGGG + Intergenic
1040315896 8:46260753-46260775 AGGCAGAGGGGAGAAGCAGCGGG + Intergenic
1040330465 8:46383220-46383242 AGGCAGAGGGAAGAAGCAGCGGG + Intergenic
1041197341 8:55413332-55413354 ACTCAGAGGGCTGAAGCAGCAGG - Intronic
1041254979 8:55972184-55972206 AGTCACGGGTCAGCAGCAGCCGG + Intronic
1043171081 8:76967480-76967502 AGTCAGAGATTAGAGGCAGCTGG - Intergenic
1044639639 8:94365239-94365261 TGTCAGAGGGTAGGAGAAGATGG + Intergenic
1045920737 8:107525753-107525775 AGTCAGAAGGTAGAAGTAGGGGG - Intergenic
1046576748 8:116039447-116039469 GGTCAGAGGTTAGAAGAAGCAGG + Intergenic
1047246710 8:123152425-123152447 AGGCAGAGGGCAGAAGGAGCTGG - Intergenic
1049034322 8:140062478-140062500 AGGCAGGGAGAAGCAGCAGCTGG - Intronic
1049273808 8:141709696-141709718 GGTCAGAGGGCAGCATGAGCGGG + Intergenic
1049277740 8:141728368-141728390 AGGCCCCGGGTAGCAGCAGCTGG - Intergenic
1051480604 9:17556084-17556106 AGTCAGAGGGTCAAATCAGCTGG + Intergenic
1051546797 9:18284557-18284579 AGTTAGAAAGTAGCAGCACCAGG + Intergenic
1053412036 9:37922155-37922177 AGGCAGAGGGTCACAGCCGCTGG + Intronic
1055236974 9:74133905-74133927 AGGCAGAGAGGAGAAGCAGCTGG - Intergenic
1056455845 9:86758962-86758984 AATGAGATGGTAGCAGCAGTCGG - Intergenic
1056753727 9:89369283-89369305 GATCAGAGGGCAGCAGCAGAAGG - Intronic
1058091983 9:100814798-100814820 ACTCAGAGGATACCAGCAGTGGG - Intergenic
1058130932 9:101252374-101252396 AGCCAGAGGGAAGCAGGTGCAGG + Intronic
1058949378 9:109889500-109889522 AGAGAGAGGGTAGGAGCTGCAGG - Intronic
1059235834 9:112760141-112760163 ACCCAGAGAGTAGCAGTAGCAGG + Intronic
1059403543 9:114085751-114085773 AGCCAGTGGGTGGCAGAAGCGGG - Intergenic
1059405422 9:114096110-114096132 AGTGAGAAGGTAGCAGCCACGGG - Exonic
1059800072 9:117741361-117741383 AGTCAGAGGCTAGGACCAACAGG - Intergenic
1059843876 9:118249272-118249294 AGTCAGTGAGAAGAAGCAGCAGG - Intergenic
1060405653 9:123371763-123371785 CGCCAGAGGGTAGGAGCAGCTGG - Intronic
1060688556 9:125635181-125635203 AATCAGAGGGTAGGATTAGCAGG - Intronic
1060927606 9:127465814-127465836 AGTCAGAGGTTGGCAGCGGGAGG + Intronic
1061238510 9:129355876-129355898 AGTCAGAGAATAGCAGGAGCTGG + Intergenic
1061274156 9:129559746-129559768 GGTCAGAGGGCACCTGCAGCAGG + Intergenic
1061606155 9:131712446-131712468 AGTCAGAGGGTATGGGCGGCTGG + Intronic
1061705609 9:132450856-132450878 AGTGAGAGGTAAGCAGCAGAGGG + Intronic
1062630844 9:137462446-137462468 GGGGAGAGGGTAGCAGCACCCGG + Intronic
1203522010 Un_GL000213v1:53822-53844 ATTCAGACTGTAGCTGCAGCAGG + Intergenic
1187876847 X:23811260-23811282 AGTCAAAGGGTTTAAGCAGCAGG + Intergenic
1188875028 X:35418940-35418962 ACTTTGAGGGTGGCAGCAGCCGG - Intergenic
1188928163 X:36070989-36071011 AGGCAGAGGGTAGCAGCTCAGGG - Intronic
1189056093 X:37700803-37700825 AGTCAGAGGGCAGTAGCCACAGG + Intronic
1189815122 X:44817084-44817106 AGTCAGATGGTGGCAGGTGCTGG + Intergenic
1189921095 X:45903966-45903988 ACTCAGAGATTAGCAACAGCAGG + Intergenic
1190502842 X:51096607-51096629 AGTCAGAGGTGAGAAGCAGAGGG + Intergenic
1194844417 X:98786588-98786610 AGTGAGATGGTAGCAAAAGCAGG - Intergenic
1194878936 X:99225817-99225839 CGACAGAGAGTAGAAGCAGCTGG + Intergenic
1200237740 X:154476882-154476904 ATTCAGAGCGTCCCAGCAGCTGG + Intergenic
1200950309 Y:8892420-8892442 AGTGTGAGTGTATCAGCAGCAGG - Intergenic