ID: 1126134656

View in Genome Browser
Species Human (GRCh38)
Location 15:45378519-45378541
Sequence TCCCGAGAGCGCGCCCGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126134652_1126134656 -5 Left 1126134652 15:45378501-45378523 CCGCGTCGGTCCAAGCCTTCCCG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1126134650_1126134656 8 Left 1126134650 15:45378488-45378510 CCTGGCCTCTGGGCCGCGTCGGT 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1126134651_1126134656 3 Left 1126134651 15:45378493-45378515 CCTCTGGGCCGCGTCGGTCCAAG 0: 1
1: 0
2: 0
3: 6
4: 36
Right 1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1126134646_1126134656 24 Left 1126134646 15:45378472-45378494 CCACGCGCGGAATGTTCCTGGCC 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126134656 Original CRISPR TCCCGAGAGCGCGCCCGGAG CGG Exonic
900419707 1:2550622-2550644 TCCCCAGAGGGCGGCTGGAGGGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
904699815 1:32351591-32351613 TCACGTGAGTGCGCCGGGAGGGG - Intronic
905449551 1:38047524-38047546 CCCTGAGAGCGCGTCCGGTGCGG + Intergenic
910853343 1:91670141-91670163 TCCTGAGAGCGCTCCCGGGAAGG - Intergenic
922689878 1:227679835-227679857 TCCTGAGAGCGCTCCCGGGTAGG + Intergenic
923505215 1:234599967-234599989 TCCAGAGAGCGCGCCGGCGGCGG + Intergenic
1065930763 10:30476685-30476707 TCCTGAGAGCGCTCCCGGGTAGG + Intergenic
1065968095 10:30784990-30785012 TCCCCAGAGCGCGCAGGGAGCGG + Intergenic
1068672066 10:59733447-59733469 TCCTGAGAGCGCTCCCGGGTAGG - Intronic
1070314137 10:75294795-75294817 GCCCGGGAGGGCGCGCGGAGGGG + Intergenic
1077495262 11:2884183-2884205 ACCCGAGAGGGGGCCGGGAGAGG + Intronic
1079128803 11:17735816-17735838 ACCCGACAAAGCGCCCGGAGAGG + Exonic
1080283890 11:30586414-30586436 GCCGGGGAGCGCGCACGGAGCGG - Intronic
1083830085 11:65225934-65225956 TCCCAGGAGCGAGCCCGGCGCGG - Intergenic
1083879230 11:65540007-65540029 CCCCGAGAGCCCGGCCGGTGAGG - Exonic
1084191647 11:67502134-67502156 TCCCAAGAGGGTGCCAGGAGCGG - Intronic
1098748012 12:74264876-74264898 TCCTGAGAGCGCTCCCGGGTGGG + Intergenic
1101592921 12:106139275-106139297 GCCCGAGAGCGCCCGGGGAGGGG - Exonic
1103413032 12:120726036-120726058 GGCCGTGAGCGCTCCCGGAGTGG - Intronic
1104841482 12:131828109-131828131 ACCCGGGAGCGCGGCCGGAGAGG + Intergenic
1104963661 12:132499612-132499634 TCCCGAGAGCCCGTCAGGAAGGG + Intronic
1107419411 13:40232839-40232861 GCCTGAGAGTGCTCCCGGAGGGG - Intergenic
1108583364 13:51846114-51846136 GCCCTAGAGTGAGCCCGGAGAGG - Intergenic
1111951683 13:94713155-94713177 TCCCAGGAGCGCGCCGAGAGGGG - Intergenic
1115687162 14:35808646-35808668 TCCCGAGAGAGAGTCCGCAGGGG + Intronic
1121226378 14:92324238-92324260 TCCCGGGAGTGCGCCCGGAATGG + Intronic
1122802284 14:104237737-104237759 TCCAGAGAGAGGGTCCGGAGGGG - Intergenic
1124518790 15:30392972-30392994 TCCCAAGAGGGCTCCCGCAGCGG + Intronic
1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG + Exonic
1131054415 15:89367294-89367316 GGCCGAGAGCGCTCACGGAGAGG - Intergenic
1132544964 16:528661-528683 CCCCGAGAGCTCGCCCGGCCAGG - Intronic
1132785731 16:1656227-1656249 CCCCGAAAGCGCCCCCGGGGAGG + Exonic
1139402769 16:66696057-66696079 TCCCGGGAGCGAGGGCGGAGCGG + Intronic
1141456425 16:84145255-84145277 TCCCGAGTGCGCGTGCGCAGCGG + Intergenic
1143183490 17:4997904-4997926 ACGCGCGAGCGCGCGCGGAGGGG - Intergenic
1143198812 17:5097848-5097870 GCCCCAGAGCCCGCCCGGTGCGG - Intergenic
1160452464 18:78974562-78974584 TCCCGGGAGCGCCGGCGGAGAGG - Intergenic
1162486140 19:10961433-10961455 CGGCGAGAGCGCGCGCGGAGAGG - Intronic
1163991508 19:21002968-21002990 TCCTGAGAGCGCTCCCAGATAGG + Intergenic
1166041616 19:40206171-40206193 TCCCCAGAGCGCCCCCCAAGAGG + Intronic
1167258394 19:48443984-48444006 GCCCGAGGGGGCGCCCGCAGTGG + Exonic
925800940 2:7599725-7599747 TGCCCAGAGCGCACCGGGAGCGG + Intergenic
927110105 2:19858470-19858492 TCCCGAGACCGAGACCGGAGAGG - Intergenic
930517865 2:52431398-52431420 TCCTGAGAGCGCTCCCGGGTAGG + Intergenic
936419867 2:112353400-112353422 TCCTGAGAGCGCTCCCGGGTAGG - Intergenic
938058345 2:128233417-128233439 TCCCGAGACCGTCCCCGGAAAGG - Intergenic
945119470 2:206443423-206443445 CCCCGAGAGCGCGCCCGAGCGGG - Intergenic
947723319 2:232381929-232381951 TCCCCAGAGCGCACGGGGAGGGG - Exonic
1168855078 20:1002394-1002416 GCCCGGGAGCGCGCGCGGGGAGG + Intergenic
1170573383 20:17645285-17645307 TCCCGAGAGTGTTCTCGGAGCGG + Intronic
1174019865 20:47521245-47521267 ACCAGAGACCGCCCCCGGAGGGG + Intronic
1175429604 20:58891948-58891970 TCGGGAGCGCGCGCCCGGGGCGG - Intronic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1184523248 22:45007892-45007914 TCCCCGGAGGGGGCCCGGAGGGG + Intronic
951248830 3:20370838-20370860 TCCTGAGAGCGCCCCCGGGTAGG - Intergenic
962575416 3:136751793-136751815 TCCCGAGAGCCCGGGCGGGGGGG + Intronic
963081974 3:141402666-141402688 TCCGGGGCCCGCGCCCGGAGCGG + Intronic
965558130 3:170038069-170038091 TCCCGGGAGCGCGCGGGGCGGGG + Exonic
976148763 4:82071382-82071404 TCCTGAGAGCAAGCCTGGAGAGG + Intergenic
981604354 4:146526483-146526505 TCCTGAGAGCGCTCCCAGGGAGG + Intergenic
982662962 4:158228605-158228627 TCCTGAGAGCGCTCCCGGGTAGG - Intronic
982745800 4:159103368-159103390 CCCCATCAGCGCGCCCGGAGCGG - Intergenic
983897682 4:173099277-173099299 TCCTGAGAGCGCTCCCGGGTAGG + Intergenic
988949263 5:36241413-36241435 TCCCGAGAGGTCCCCCCGAGGGG + Intronic
1013152468 6:107459627-107459649 ACCCGAGAACGCCCCCGCAGGGG + Intergenic
1013366318 6:109440813-109440835 TCCGGAGAGCGCCCCCGGGTGGG - Exonic
1014233871 6:118934521-118934543 TCCCGCCAGCCCGCGCGGAGGGG - Intronic
1014547371 6:122748658-122748680 TCCTGAGAGCGCTCCCGGGTAGG - Intergenic
1022096385 7:27144064-27144086 TGCCGATCGCGCGCCCGGCGAGG + Intronic
1022489826 7:30808106-30808128 TCCTGAGAGCGCTCCCGGGTAGG + Intronic
1024364106 7:48501407-48501429 TCCCTAGAGCGCCCCATGAGAGG + Intronic
1029821717 7:103152932-103152954 TCCTGAGAGCGCTCCCGGGTAGG + Intergenic
1031531999 7:122886664-122886686 TCCCCAGAGCCCGCCGGCAGAGG + Intronic
1032979758 7:137268205-137268227 TCCTGAGAGCGCTCCCGGGTAGG - Intronic
1034306654 7:150049081-150049103 GCCCGAGAGCGCGCGGCGAGTGG - Intergenic
1034800191 7:154051562-154051584 GCCCGAGAGCGCGCGGCGAGTGG + Intronic
1035680320 8:1483049-1483071 TCCGGCGCGCGCGGCCGGAGAGG + Intergenic
1036493568 8:9249799-9249821 TCCTGAGAGCGCTCCCGGGTAGG + Intergenic
1043871512 8:85438637-85438659 TCCCGGGAGAGCGCAGGGAGGGG + Intronic
1045443777 8:102239512-102239534 TCAGGAGTGGGCGCCCGGAGTGG - Intergenic
1045582668 8:103498822-103498844 CCCGGAGAGCCCTCCCGGAGGGG - Intergenic
1053312785 9:37029938-37029960 TCCCGAGAGCGGCTCTGGAGAGG - Intronic
1060825034 9:126683057-126683079 TCCCGACAGCGCCCCTGGCGCGG + Intronic
1061398275 9:130355114-130355136 TCCCGAGAGAGCTCCTGGAGTGG + Intronic
1203760801 EBV:12417-12439 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203761730 EBV:15489-15511 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203762659 EBV:18561-18583 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203763588 EBV:21633-21655 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203764517 EBV:24705-24727 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203765446 EBV:27777-27799 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203766375 EBV:30849-30871 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203767304 EBV:33921-33943 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1186558902 X:10589706-10589728 TCCTGAGAGCGCTCCCGGGTAGG - Intronic
1190426465 X:50338111-50338133 TCCTGAGAGCGCTCCCGGGTAGG - Intronic
1196423352 X:115545051-115545073 TCCTGAGAGCGCTCCCGGGTAGG - Intergenic
1200394704 X:155977062-155977084 TCCTGAGAGCGCTCCCGGGTAGG - Intergenic