ID: 1126136375

View in Genome Browser
Species Human (GRCh38)
Location 15:45396409-45396431
Sequence CAATTTAGGGAGAGATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126136368_1126136375 23 Left 1126136368 15:45396363-45396385 CCAGTCAAAGTATAAGAGATTTT 0: 1
1: 0
2: 1
3: 14
4: 241
Right 1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 267
1126136367_1126136375 30 Left 1126136367 15:45396356-45396378 CCTCAAACCAGTCAAAGTATAAG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126136375 Original CRISPR CAATTTAGGGAGAGATTGGA GGG Intronic
902398998 1:16147341-16147363 CTGTTGAGGGAGAGGTTGGAGGG - Intronic
902728589 1:18353335-18353357 CAACTTGGGCAGGGATTGGAGGG + Intronic
905649309 1:39645970-39645992 CCAATTAGGGATAGAGTGGATGG - Intergenic
906283735 1:44571904-44571926 GAATTTAGGGATTGATTAGATGG - Intronic
909537735 1:76757152-76757174 GAATTTTGGGATAGATTAGATGG - Intergenic
910509825 1:87991307-87991329 TTATTTAGGGAGAGAAAGGAGGG + Intergenic
910600463 1:89026242-89026264 CAATTTAAGGTGAGATTTGGGGG + Intergenic
911003041 1:93187513-93187535 TAATTTCGAGAGAGACTGGAAGG + Intronic
911452750 1:98085788-98085810 CAGATTAGGGACAGATTAGATGG + Intergenic
911468939 1:98291868-98291890 CAATTTTGTGAGAGTTTCGATGG + Intergenic
911933664 1:103938099-103938121 CAATTCAGTGTGAGATTTGAAGG - Intergenic
912085328 1:105995446-105995468 TCATTCAGGGAGAGATTAGAGGG + Intergenic
913008797 1:114662368-114662390 AAATTCAGGGACAGATTGGTGGG - Intronic
913145570 1:115986557-115986579 GGATTTAGGGAGAAATGGGAAGG + Intronic
913962048 1:143347551-143347573 CAATTTTGGGAGAATTTTGATGG + Intergenic
914056404 1:144173126-144173148 CAATTTTGGGAGAATTTTGATGG + Intergenic
914122742 1:144793236-144793258 CAATTTTGGGAGAATTTTGATGG - Intergenic
914412794 1:147447548-147447570 CTACTTAGAGAGAGATTAGATGG + Intergenic
915605597 1:156948188-156948210 CCATTTTGGGAGTGAATGGAGGG + Exonic
916310932 1:163398152-163398174 CAAGTAAGGGACGGATTGGAAGG + Intergenic
917151358 1:171948562-171948584 CACTTTAGAGAGAAAATGGATGG + Intronic
917201039 1:172515742-172515764 TATTTTAGGGAAACATTGGATGG + Intergenic
917867778 1:179213680-179213702 CAATATAGGGAGGAAATGGATGG + Intronic
918837494 1:189486419-189486441 CAATGTAGGGAAATAATGGAAGG - Intergenic
918849626 1:189669487-189669509 CAATATCGGGAAAGAATGGAGGG + Intergenic
918939751 1:190977399-190977421 CAATTTAGACAGAGAGTGAATGG - Intergenic
919284468 1:195537403-195537425 GAATTTATGAAGATATTGGAGGG + Intergenic
919992148 1:202715512-202715534 CAATTTATGGAGAGTTTTAATGG - Intergenic
921091177 1:211844887-211844909 CAATTTTGTGAGAGTTTTGACGG - Intergenic
922751440 1:228071894-228071916 CAGTTTAGGGGGAGAGTGTAGGG + Intergenic
923785022 1:237058185-237058207 CAGTCTAGGGATATATTGGAGGG + Intronic
923871027 1:237994435-237994457 CAATTTATTAAGAGATGGGAGGG - Intergenic
924191851 1:241561739-241561761 CAAGGTAGGGAGAGAAAGGAAGG - Intronic
1063642262 10:7841665-7841687 CAAATTTGGGAGATATTGGATGG + Intronic
1064509285 10:16071916-16071938 CAAGTTAAGAAGAGATTGGAGGG + Intergenic
1067945904 10:50687759-50687781 CCATTTAGGGGCAGATTGTAGGG - Intergenic
1067983524 10:51115470-51115492 CAAATTTGGGAGAGGTAGGATGG + Intronic
1070867420 10:79714635-79714657 CCATTTAGGGGCAGATTGTAGGG - Intronic
1070881212 10:79852759-79852781 CCATTTAGGGGCAGATTGTAGGG - Intergenic
1071517287 10:86306580-86306602 CACAGGAGGGAGAGATTGGAGGG - Intronic
1071634334 10:87236858-87236880 CCATTTAGGGGCAGATTGTAGGG - Intronic
1071647785 10:87369075-87369097 CCATTTAGGGGCAGATTGTAGGG - Intronic
1072746955 10:97947100-97947122 CAATTTAGGGACAGAATAGTTGG + Intronic
1074294474 10:112171050-112171072 GAATTTAGAAAGAGACTGGAAGG - Intronic
1074411881 10:113235620-113235642 CAGATTGGGGATAGATTGGATGG + Intergenic
1075834225 10:125439903-125439925 CAATTCAGGGAGAGAGAGGTGGG + Intergenic
1078731692 11:13980846-13980868 CAACTTAGGGTCAGATTTGAAGG - Intronic
1079397273 11:20075708-20075730 CAATCTAAGGAGAGATGTGAGGG - Intronic
1079558822 11:21795195-21795217 CAATATAGGTAGAGAGTAGATGG - Intergenic
1081365537 11:42230538-42230560 TAATTTATGGAGAGAGAGGAGGG + Intergenic
1082787748 11:57326188-57326210 TAATTTGGGGAGAGATAGGGTGG - Exonic
1083131691 11:60630816-60630838 CAATTTTGTGAGAACTTGGATGG - Intergenic
1087729928 11:101767502-101767524 CAATTCAAGGTGAGATTGGGTGG + Intronic
1088444377 11:109908476-109908498 CATTTCAAGGAGAGATTTGAGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1092592990 12:9968020-9968042 AAATTAAGAGAGAGATTGAAGGG + Intronic
1095511603 12:42956674-42956696 CAGTGTGGGGAAAGATTGGAAGG - Intergenic
1096793995 12:54062534-54062556 GAATTCTGGGAGGGATTGGAGGG - Intergenic
1097262905 12:57729487-57729509 CAACTTAGTGAAAGAGTGGATGG - Intronic
1097412691 12:59274515-59274537 CAATTCTGTGAGAGTTTGGATGG - Intergenic
1098782544 12:74705240-74705262 CAATTCAAGATGAGATTGGATGG - Intergenic
1099165533 12:79302495-79302517 CAATTTAGAAAGAAATGGGAAGG + Intronic
1100106404 12:91179039-91179061 TAGTTTAGGGAGAGATGAGAAGG - Intronic
1100922100 12:99499751-99499773 CAATTTGGGGAGGGCTTGGCAGG - Intronic
1101314739 12:103618827-103618849 CAATTTAAGGTGAGACTGGGTGG - Intronic
1101559291 12:105840824-105840846 CAAGGTAGGGAGAGAAGGGATGG - Intergenic
1102727103 12:115075293-115075315 CATTTGAGGGAGAGAGAGGAGGG - Intergenic
1104322075 12:127761298-127761320 GACTTCAGGGAGAGAGTGGAGGG + Intergenic
1104381626 12:128312591-128312613 CAATGGAGGCAGACATTGGAGGG + Intronic
1110755641 13:79171123-79171145 CAATTTAGGGAGATAAGGGCAGG + Intergenic
1110907474 13:80910540-80910562 CAAGTTAGGGAGAGATTCTAGGG + Intergenic
1111336417 13:86830543-86830565 CAATTTTGTGAGAGTTTTGATGG + Intergenic
1112269321 13:97953781-97953803 CAATTTAGCGTGATACTGGAGGG + Intronic
1112979036 13:105358626-105358648 CAATTCAGGATGAGATTGGGTGG - Intergenic
1116529415 14:45949592-45949614 GAAGTGAGGGAGAGACTGGAAGG - Intergenic
1116731876 14:48633099-48633121 GAATCTAGGGAGAGAATGAAAGG - Intergenic
1117031180 14:51672376-51672398 CAATTTTGGGAGAGTTTTGATGG + Intronic
1119157775 14:72427496-72427518 CAATTTGGGCAGAGGTTGGTCGG - Intronic
1119412783 14:74444979-74445001 CATTTCAGTGTGAGATTGGAAGG - Intergenic
1119987789 14:79158929-79158951 CAATTTTGTGAGAGTTTTGATGG - Intronic
1120446751 14:84607806-84607828 ATATTTTAGGAGAGATTGGAAGG - Intergenic
1120721238 14:87891653-87891675 AAATTCAGAGAGAGATTTGAAGG + Intronic
1122664542 14:103319382-103319404 CAGGTTAGGGAGAGCCTGGAAGG - Intergenic
1123142115 14:106090366-106090388 CATTTTAGGGAAAGAATGGGAGG + Intergenic
1123186287 14:106520377-106520399 CATTTTAGGGAAAGAATGGAAGG + Intergenic
1123887595 15:24742206-24742228 CAATTTGTGGAGGGAATGGAGGG - Intergenic
1125042803 15:35211539-35211561 CAATTTAGAAAGATAGTGGATGG - Intergenic
1125477083 15:40054773-40054795 CCATTTGGGAATAGATTGGATGG + Intergenic
1126000195 15:44202150-44202172 CAATTTTGTGAGAGTTTTGATGG - Intergenic
1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG + Intronic
1126718393 15:51548668-51548690 CATTTGAGGGGGAGATTGGTGGG - Intronic
1127822320 15:62669565-62669587 CAATTTAAGGAGACAGTGGGAGG + Intronic
1132438391 15:101832860-101832882 CAATTTTGTGAGAGTTTTGATGG + Intergenic
1133033462 16:3022322-3022344 TATTTTGGGGAGAGTTTGGAGGG + Exonic
1133185615 16:4095559-4095581 TATTTTAGAGAGAGATTGGAAGG - Intronic
1134566623 16:15257329-15257351 CAATTCAAGGTGAGTTTGGATGG + Intergenic
1134735871 16:16499370-16499392 CAATTCAAGGTGAGTTTGGATGG - Intergenic
1134931648 16:18212784-18212806 CAATTCAAGGTGAGTTTGGATGG + Intergenic
1136100330 16:27990307-27990329 CAAATTATGGAGAAATTAGAGGG - Intronic
1136383488 16:29908257-29908279 CAATTGAGGCAGAGATGAGAGGG + Intronic
1136682967 16:31978659-31978681 CACTTTAGAGAGAGATTCCATGG + Intergenic
1136783608 16:32922215-32922237 CACTTTAGAGAGAGATTCCATGG + Intergenic
1136886183 16:33931591-33931613 CACTTTAGAGAGAGATTCCATGG - Intergenic
1140793029 16:78410454-78410476 GAATTTAGGGACAGTTTGGCTGG + Intronic
1141767859 16:86070573-86070595 CAATTTGGGTAGGGTTTGGAGGG + Intergenic
1203086254 16_KI270728v1_random:1186209-1186231 CACTTTAGAGAGAGATTCCATGG + Intergenic
1142635783 17:1256753-1256775 CACTTTAGTGAGAGAACGGAGGG + Intergenic
1144491968 17:15720917-15720939 CAACTTCTGGAGAGATGGGATGG + Intergenic
1144908509 17:18658277-18658299 CAACTTCTGGAGAGATGGGATGG - Intronic
1146697205 17:34918791-34918813 CAATTCAAGTTGAGATTGGATGG - Intergenic
1147143871 17:38474368-38474390 CACTTTAGAGAGAGATTCCAGGG + Intronic
1148393972 17:47294087-47294109 AATTTTAGAGAGAGTTTGGAAGG + Intronic
1155859344 18:30877395-30877417 CTATTTAGGGAGAGAGTGGATGG + Intergenic
1157768473 18:50323764-50323786 CAATTTTGTGAGAGTTTTGATGG + Intergenic
1159057804 18:63483672-63483694 CAATGGAGGCAGAGATTGGAGGG - Intronic
1159872489 18:73774332-73774354 CAATATTGAGTGAGATTGGATGG + Intergenic
1160305151 18:77726357-77726379 CAATTTTGTGAGAGTTTTGATGG + Intergenic
1162644952 19:12042003-12042025 CAACTTAGGGACAAATTCGAAGG - Intronic
1166403539 19:42502529-42502551 CAATTCAGGTAGTGATTGCATGG - Intergenic
1202695885 1_KI270712v1_random:125803-125825 CAATTTTGGGAGAATTTTGATGG + Intergenic
926081190 2:9987723-9987745 CAATGCAGGGAGAGTCTGGAAGG + Intronic
933031244 2:77331497-77331519 CAATAAAAGGAGAGAATGGATGG - Intronic
933377366 2:81497104-81497126 AAATGAAGGGAGAGATTGCAGGG + Intergenic
934277050 2:91582848-91582870 CAATTTTGGGAGAATTTTGATGG + Intergenic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
941599269 2:167520387-167520409 CAATTTTGGGAGAGTTTTGATGG - Intergenic
941634332 2:167919223-167919245 CAATTTTGTGAGAGTTTAGATGG + Intergenic
942641845 2:178068904-178068926 CATTTTAAGTAGAGAATGGAAGG + Intronic
942820960 2:180114859-180114881 CAATTTAGGGTGAGTTTCAATGG + Intergenic
943928847 2:193823326-193823348 CAATTTTGTGAGAGTTTTGATGG - Intergenic
944311324 2:198236969-198236991 CACCTTGGTGAGAGATTGGAGGG + Intronic
944609008 2:201380978-201381000 GGATTTAGGGAGAGGCTGGAGGG + Exonic
946998067 2:225418531-225418553 GAATTTGGTGACAGATTGGATGG + Intronic
947298166 2:228656277-228656299 CAATTCAAGGAGAGAAAGGAAGG + Intergenic
947967580 2:234294385-234294407 CCATTTAGTGGGAGATTGCATGG + Intergenic
1170454443 20:16519274-16519296 AAAATTAGGGAAAGATAGGAAGG - Intronic
1170770430 20:19328013-19328035 CAAGTTGGGGGGAGTTTGGAGGG + Intronic
1172823910 20:37763698-37763720 CAATGACGGGAGAGAATGGAGGG - Intronic
1173058694 20:39640915-39640937 GAATTTAGGAAGAGTTTGGCAGG - Intergenic
1173686646 20:44928525-44928547 CAATTTAGGGGGAAATTGCATGG - Intronic
1176407886 21:6431329-6431351 AAGTTTAGGGGGAGCTTGGAAGG + Intergenic
1179165356 21:38931338-38931360 CAATTTAATGAGAGATGGGTGGG - Intergenic
1179683377 21:43039660-43039682 AAGTTTAGGGGGAGCTTGGAAGG + Intergenic
1183340582 22:37278552-37278574 CCTTTGAGGGAGAGATAGGAAGG - Intergenic
955041123 3:55318869-55318891 TAAATTAGGGAGAAAATGGAGGG - Intergenic
955578493 3:60393032-60393054 CAATTTTGTGAGAGTTTTGATGG + Intronic
955666893 3:61358775-61358797 AAATCTAGGAACAGATTGGATGG - Intergenic
955673565 3:61427247-61427269 GAATTAAGGGAGAGAGGGGAGGG + Intergenic
956106534 3:65824662-65824684 CAACTTAAGGAGGGAATGGAGGG - Intronic
956923627 3:73957962-73957984 CAATTTTGTGAGAGTTTTGATGG + Intergenic
957167070 3:76688818-76688840 CAAGAGAGGGAGAGATTGAAAGG - Intronic
958020028 3:87983435-87983457 GAATTTAGGGAGTGATTCCAGGG - Intergenic
959451304 3:106506458-106506480 CAATTTTGTGAGAGTTTTGATGG - Intergenic
959959593 3:112282536-112282558 CAATTTTGTGAGAGTTTTGATGG + Intronic
960735497 3:120775044-120775066 TAATTTAGGGAAAGATGTGATGG + Intronic
963955583 3:151250017-151250039 CATTTAAGGGAGAGCTTTGAGGG - Intronic
964602984 3:158523734-158523756 CAATTTTGTGAGAGTTTTGATGG - Intronic
965812847 3:172609795-172609817 CAATTCAAGATGAGATTGGATGG - Intergenic
969033712 4:4233536-4233558 CAATTTTGGGAGAATTTTGATGG - Intergenic
970991644 4:22220090-22220112 CAATTTAAGGTGAGATTTGTGGG - Intergenic
971912234 4:32809559-32809581 CAATTAAAGGACAGATTGGGAGG + Intergenic
972482424 4:39510030-39510052 CAATTTGAGGAGACAATGGATGG + Intronic
972614672 4:40686625-40686647 TAATTTAGGGAGAGTATGAAGGG + Intergenic
974903573 4:68031537-68031559 AAATGAAGGGAGAGATTGAAGGG - Intergenic
975959023 4:79878176-79878198 CAATTTAGGGAGAGACCTGGTGG + Intergenic
976145367 4:82037683-82037705 CATTTTAAGGAGAGAAGGGATGG + Intronic
976807834 4:89067984-89068006 CATTTTAGATGGAGATTGGAAGG - Intronic
976847418 4:89505753-89505775 CAATAGAGGGAGAGATGGGAAGG - Intergenic
978597395 4:110393162-110393184 GAATTAAGGAAGAGAATGGAAGG + Intronic
981532045 4:145762553-145762575 CAATTTAGGTAGATTCTGGAAGG + Intronic
981759631 4:148179628-148179650 CAATTTAATGAGAGTTTTGAAGG + Intronic
981831304 4:149005258-149005280 CAATTTAAGATGAGTTTGGATGG - Intergenic
983664941 4:170170885-170170907 TACTTTAGGGAGAGGTTAGAGGG + Intergenic
984131164 4:175877786-175877808 CAATTTAGGGGATTATTGGAAGG - Intronic
985035440 4:185835063-185835085 AGACTTAGGGAGAGATTGGGGGG - Intronic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
985186858 4:187326897-187326919 CAATTTAAGATGAGATTGGGGGG + Intergenic
987519593 5:18963537-18963559 CAATTTAGTGAGAGAAAAGAAGG + Intergenic
987811152 5:22838053-22838075 CATTGTAGGGAGATATTTGATGG + Intronic
988283088 5:29174927-29174949 AGATTTTGGGAGAGATAGGAAGG + Intergenic
988647011 5:33105744-33105766 CAAGTTAAGGAGAGATTTGGAGG - Intergenic
989006376 5:36817584-36817606 CAATTCAGGATGAGATTTGAGGG + Intergenic
989786767 5:45341894-45341916 CAATTTTGTGAGAGTTTTGATGG + Intronic
990686718 5:58311510-58311532 CAATCTAAGGACAGATTTGAGGG - Intergenic
991145095 5:63292632-63292654 CATTTCAGGTAGAGAGTGGAGGG + Intergenic
991602304 5:68365845-68365867 GAATTTAGGAAGAGATGGGAGGG + Intergenic
992390624 5:76327541-76327563 CAAATCAGGGAGAGATAGGTGGG - Exonic
993861819 5:93145483-93145505 TAACTGAGGGAGTGATTGGATGG - Intergenic
993884089 5:93396387-93396409 GAATTTATGGAGAGAAAGGAGGG - Intergenic
994435398 5:99723988-99724010 CAATTTTGTGAGAGTTTTGATGG + Intergenic
995970384 5:117962847-117962869 CATTTTGGGGATAGATTGCATGG - Intergenic
999212478 5:149902167-149902189 AAATTGAGGGAGAGACTGGCAGG - Intronic
1000604307 5:163311961-163311983 CACATAAGGGACAGATTGGAGGG + Intergenic
1000915385 5:167075084-167075106 CAATTTTGGAAGAAATAGGAAGG + Intergenic
1001774515 5:174318846-174318868 CATTTTAGGAAAACATTGGATGG - Intergenic
1002479428 5:179490180-179490202 CAATTTAAGGCTAGATTGGCTGG - Intergenic
1003519893 6:6849535-6849557 CAATTTAAGAAGAGATTGTTGGG - Intergenic
1004669908 6:17785980-17786002 CATTTTAGGGACATAGTGGATGG - Intronic
1005318538 6:24628789-24628811 CAATAGAGGGACAGATTGGAGGG - Intronic
1005329779 6:24738683-24738705 CAATTTCGGCAGGGCTTGGAGGG + Intergenic
1005349517 6:24920461-24920483 CAATTTAAGGAAAGATCAGAGGG - Intronic
1006202745 6:32311284-32311306 AGATTTAGGGAGAGATTGGGTGG - Intronic
1006544991 6:34773376-34773398 CGATTTAGGGAGAGTTTGATGGG - Intronic
1007987153 6:46218267-46218289 CAGTTTAGGATGAGGTTGGAAGG - Intergenic
1008589398 6:52978069-52978091 AAAATTAGGCAGAGACTGGAGGG + Exonic
1008712731 6:54248018-54248040 CAAATTAGGAAGACCTTGGATGG + Intronic
1010710945 6:79173524-79173546 CCATGGAGGCAGAGATTGGAGGG + Intergenic
1010744247 6:79542668-79542690 GCATTTAGGGAGAGGTTGGAAGG + Intergenic
1012008916 6:93754745-93754767 CCATAGAGGCAGAGATTGGAGGG + Intergenic
1012028020 6:94023031-94023053 CAATTTTGGAAGAGTTTTGATGG - Intergenic
1012712736 6:102629038-102629060 CAATTTTGGGAGAAAGGGGAAGG - Intergenic
1013897288 6:115104313-115104335 CAATTTTGTGAGAGTTTTGATGG + Intergenic
1015088981 6:129331223-129331245 GAATTTAAGGTGAGATTAGATGG - Intronic
1017615260 6:156240533-156240555 GAAATTGGGGAGAGTTTGGAAGG - Intergenic
1018102481 6:160453572-160453594 CTATTTAGGGTGACAGTGGAGGG - Intergenic
1018265519 6:162020263-162020285 GAATATAGGGAGAGCTTGGATGG + Intronic
1019226356 6:170513322-170513344 AAAGCTAGGGAGAGAGTGGAAGG + Intergenic
1020128746 7:5547752-5547774 CAATTTAGGGAGAGCCTGACAGG - Intronic
1021121219 7:16797922-16797944 AAATTAAGGGAGAATTTGGAAGG + Intronic
1022067577 7:26875311-26875333 CCAATTAGAGAGAGAGTGGATGG + Intronic
1022612977 7:31895642-31895664 CAATTCAAGGTGAGATTGGGTGG - Intronic
1023757999 7:43437956-43437978 CAATTAACTGAGAGGTTGGAGGG - Intronic
1026013648 7:66655291-66655313 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1026025652 7:66741452-66741474 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1026222736 7:68414704-68414726 CAATTCAGGGAGAACTTGGAAGG - Intergenic
1027909342 7:84228908-84228930 CAATTTAGAAAGATATTGGTGGG - Intronic
1027928622 7:84500718-84500740 AAATTTATGGAGAGATAGAAGGG - Intergenic
1029821039 7:103147915-103147937 TAATTTAAGGAGAGATTGAGGGG - Intronic
1030496421 7:110306467-110306489 TAATTCAGGCAGAGATAGGAAGG + Intergenic
1033187229 7:139238808-139238830 AAATTTAGGGATAGACTGGTGGG + Intronic
1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG + Intronic
1033772972 7:144574131-144574153 CAATTCAAGGTGAGATTGAATGG + Intronic
1035346427 7:158202635-158202657 CCATTTAGGGAGGCATTGGCTGG - Intronic
1035919560 8:3662365-3662387 TAAGTTAGGGAGAGATGGAAAGG - Intronic
1036236863 8:7046473-7046495 GAATTCAGGGAGAGGTTTGAGGG - Intergenic
1036724269 8:11205591-11205613 CAATTGAGAGAAAGAATGGAAGG + Intergenic
1038850973 8:31275986-31276008 CAATTTAGTGAGAATTGGGAAGG - Intergenic
1039109553 8:34026649-34026671 CAATTTAAGATGAGATTGGGTGG + Intergenic
1039312693 8:36335830-36335852 GAATTAATGGAGAGATTGCATGG + Intergenic
1039651551 8:39345227-39345249 CAATTTTGTGAGAGTTTTGATGG + Intergenic
1041151444 8:54939578-54939600 CAATTTATGGAGCGCTGGGAAGG - Intergenic
1041991470 8:63997395-63997417 CAATTTTGTGAGAGCTTTGATGG + Intergenic
1042368713 8:67966503-67966525 CAATCTGGGCAGAGCTTGGAAGG + Intronic
1042623020 8:70726902-70726924 CAATTTTGTGAGAGTTTTGATGG + Intronic
1042654617 8:71082507-71082529 CAAGTGAGAGAGAGAGTGGAGGG + Intergenic
1043589380 8:81810050-81810072 CAATTTAGGTAGAGAATAGATGG + Intronic
1044648453 8:94469232-94469254 CAATTCAAGGTGAGATTGGGTGG - Intronic
1044683573 8:94805706-94805728 CAACTTAAGGAGGAATTGGATGG - Intergenic
1045620531 8:103972321-103972343 CAATTTTGTGAAAGATTTGAGGG - Intronic
1045989211 8:108286059-108286081 TGATTTAGGGAGAGTTAGGAAGG + Intronic
1046410040 8:113830168-113830190 CAATTTAGAGAGTGTTTTGAAGG + Intergenic
1048596789 8:135875106-135875128 AGATGTAGGGAGAGGTTGGATGG + Intergenic
1050140265 9:2510310-2510332 AAATTAAGGGAGAGATTGAAAGG - Intergenic
1051015480 9:12469779-12469801 CAATATAGGAACAGATTAGAGGG + Intergenic
1051174459 9:14348433-14348455 CTATTTCGGGAGAAGTTGGAGGG + Intronic
1051842328 9:21413017-21413039 CAATTTTGGTAGAGATTGAGAGG + Intronic
1052287632 9:26804720-26804742 CAACATAGCGAGAGTTTGGAAGG - Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1053133458 9:35633638-35633660 GGATTTTGGGAGAGATAGGAAGG - Intronic
1054910106 9:70446842-70446864 AAATTTTTGGGGAGATTGGAAGG + Intergenic
1055087433 9:72328347-72328369 AAATGGAGGCAGAGATTGGAGGG + Intergenic
1055103984 9:72493457-72493479 CATTTAAGGTAGAGAGTGGATGG - Intergenic
1055546117 9:77375412-77375434 CAATTTGGGGAGAGAATGATTGG + Intronic
1057022496 9:91710362-91710384 CAAGTTAGGGGGAGAAAGGAGGG + Intronic
1057353035 9:94316285-94316307 CCATTTAGGGGCAGATTGTAGGG + Intergenic
1057654711 9:96941306-96941328 CCATTTAGGGGCAGATTGTAGGG - Intronic
1058003791 9:99894740-99894762 AAAATGAGGGATAGATTGGAGGG + Intergenic
1058302990 9:103399024-103399046 CAGTTTTGGGAGAGACTGGCAGG + Intergenic
1058437993 9:104981599-104981621 CAATTGAGGCAGGGATTGGGAGG + Intergenic
1059906641 9:118993862-118993884 GAATTTAGTGAGAGGCTGGATGG + Intergenic
1060257722 9:122047279-122047301 CAATTTGAGCTGAGATTGGAAGG + Intronic
1062031243 9:134362995-134363017 TAATTTGGGGAGAGTGTGGACGG + Intronic
1187652389 X:21422862-21422884 CAATTTAAGAAAAGACTGGATGG + Intronic
1188910958 X:35847085-35847107 CAATTTGGTGAGAGTTTTGATGG - Intergenic
1189558490 X:42169024-42169046 CAATTTAGGCAAGGCTTGGAGGG + Intergenic
1190417053 X:50190528-50190550 CAGTTCAGGGAGAAATAGGAAGG + Intergenic
1190572626 X:51799584-51799606 CAATTTTGAGAGAGTTTTGATGG - Intergenic
1191666977 X:63713535-63713557 CAGATAAAGGAGAGATTGGAGGG + Intronic
1192378450 X:70588329-70588351 GTATTAAGGGAGAGATTGGGTGG + Intronic
1192771718 X:74199622-74199644 CAATTTTGTGAGAGCTTTGATGG + Intergenic
1194931661 X:99895894-99895916 CAATTTTGGTAGAGTTTTGATGG - Intergenic
1195751996 X:108169150-108169172 CCATTTAGTGAGAGGTTGGCTGG - Intronic
1196638089 X:118027258-118027280 CAATTTTGTGAGAGTTTTGATGG + Intronic
1196933283 X:120703503-120703525 CAATTTAGGCAGAGCTTGACTGG - Intergenic
1197498954 X:127221073-127221095 CAATTCAAGGTGAGATTTGAGGG - Intergenic
1197576939 X:128225540-128225562 CAATTTAGTGAGAGAAGGCAGGG + Intergenic