ID: 1126140095

View in Genome Browser
Species Human (GRCh38)
Location 15:45430412-45430434
Sequence AAGCGCCCGAACGCGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140095_1126140104 15 Left 1126140095 15:45430412-45430434 CCAGCGCCCGCGTTCGGGCGCTT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1126140104 15:45430450-45430472 ATGTCCTGCAGGGGGCGCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 203
1126140095_1126140101 7 Left 1126140095 15:45430412-45430434 CCAGCGCCCGCGTTCGGGCGCTT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1126140101 15:45430442-45430464 GCCGCAGAATGTCCTGCAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 127
1126140095_1126140098 4 Left 1126140095 15:45430412-45430434 CCAGCGCCCGCGTTCGGGCGCTT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1126140098 15:45430439-45430461 TCAGCCGCAGAATGTCCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 123
1126140095_1126140099 5 Left 1126140095 15:45430412-45430434 CCAGCGCCCGCGTTCGGGCGCTT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1126140099 15:45430440-45430462 CAGCCGCAGAATGTCCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 117
1126140095_1126140100 6 Left 1126140095 15:45430412-45430434 CCAGCGCCCGCGTTCGGGCGCTT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1126140100 15:45430441-45430463 AGCCGCAGAATGTCCTGCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1126140095_1126140103 14 Left 1126140095 15:45430412-45430434 CCAGCGCCCGCGTTCGGGCGCTT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1126140103 15:45430449-45430471 AATGTCCTGCAGGGGGCGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140095 Original CRISPR AAGCGCCCGAACGCGGGCGC TGG (reversed) Intergenic
922786005 1:228282586-228282608 AGGGGCGCGAACTCGGGCGCTGG - Intronic
1069818425 10:71212960-71212982 AGGCGCCCGAACCAGGCCGCGGG + Exonic
1070329017 10:75404937-75404959 AAACCCCCGAAGGCCGGCGCGGG + Intergenic
1075395976 10:122127315-122127337 AAGAGCCCCAAGGCGGGCACTGG - Intronic
1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG + Intergenic
1077385837 11:2269152-2269174 ACGCGCGTCAACGCGGGCGCGGG + Intronic
1084225248 11:67711416-67711438 ACGCGCCCCAGCGCGGGAGCAGG - Intergenic
1091230069 11:133982422-133982444 AAGGGCCCGGACGCGAGCCCAGG + Intergenic
1092240745 12:6834849-6834871 AAGCGCCTGAACCCGGGAGGCGG + Intronic
1103351387 12:120286152-120286174 AATCGCCCGAACCCGGGAGGTGG + Intergenic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1111445867 13:88345515-88345537 AGGGGCACGGACGCGGGCGCGGG + Intergenic
1122722164 14:103728206-103728228 AAACGCCCGAGCGCCGGCGCCGG - Intronic
1123487733 15:20756151-20756173 CAGCGCCCGAGCGTGCGCGCGGG - Intergenic
1126140095 15:45430412-45430434 AAGCGCCCGAACGCGGGCGCTGG - Intergenic
1126438958 15:48666342-48666364 AATCGCCTGAACTCGGGAGCCGG + Intergenic
1131514667 15:93069194-93069216 AATCGCCCGAACCCGGGAGGTGG - Intronic
1132867033 16:2098293-2098315 AATCGCCTGAACGCGGGAGGTGG - Intronic
1134524743 16:14934826-14934848 AATCGCCTGAACGCGGGAGGTGG + Intronic
1134548165 16:15126119-15126141 AATCGCCTGAACGCGGGAGGTGG - Intronic
1134712331 16:16333313-16333335 AATCGCCTGAACGCGGGAGGTGG + Intergenic
1134720188 16:16376603-16376625 AATCGCCTGAACGCGGGAGGTGG + Intergenic
1134947239 16:18335282-18335304 AATCGCCTGAACGCGGGAGGTGG - Intronic
1134954497 16:18375381-18375403 AATCGCCTGAACGCGGGAGGTGG - Intergenic
1139597757 16:67968226-67968248 AAGCGGCCGGGCGCGGGCGCCGG + Intronic
1139795899 16:69482623-69482645 AAGCACCCGAAGGTGGGCCCTGG - Intergenic
1145724479 17:27105035-27105057 AAGTGCCAGACAGCGGGCGCAGG - Intergenic
1148600716 17:48892435-48892457 AAGCGCCCGAATGAAGGCTCGGG + Intergenic
1160204546 18:76822407-76822429 AGGCGCCTGAACGCGCGCACCGG - Intergenic
1160470451 18:79128144-79128166 AATCGCCCGAACCCGGGAGGAGG - Intronic
1161450684 19:4343791-4343813 GAGCGGCCGAATGCGGGAGCGGG + Exonic
1163085882 19:14979593-14979615 AAGCGCCCGGCCGGGGCCGCGGG + Intronic
1166790623 19:45396595-45396617 GAGCTCCCGAAGGCGGACGCTGG + Exonic
1167955078 19:53057967-53057989 CACCTCCCCAACGCGGGCGCAGG + Intergenic
929188557 2:39120280-39120302 CAGCCCCCCAGCGCGGGCGCTGG - Intronic
929701409 2:44166336-44166358 ATGAGCCTGAGCGCGGGCGCCGG - Intergenic
933910315 2:86934922-86934944 AATCGCCCGAACTCGGGAGGCGG - Intronic
934022412 2:87968487-87968509 AATCGCCCGAACTCGGGAGGCGG + Intergenic
936260597 2:110956982-110957004 AAGCGCCAGAACCTGGGCTCTGG - Intronic
936413877 2:112286522-112286544 AATCGCCCGAACTCGGGAGGCGG - Intronic
939921985 2:148127060-148127082 AATCGCCCGAACCCGGGAGGCGG - Intronic
940218412 2:151324897-151324919 AATCGCCCGAACCCGGGAGGTGG + Intergenic
1172971487 20:38876057-38876079 AATCGCCCGAACCCGGGAGGCGG - Intronic
1174259013 20:49279536-49279558 AATTGCCCGAACCCGGGCGGCGG + Intergenic
1176546438 21:8203805-8203827 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
1176554332 21:8247996-8248018 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
1176565389 21:8386852-8386874 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
1176573254 21:8431020-8431042 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
1180005357 21:45018364-45018386 AAGCGCCCGGACGACGGCACGGG + Intergenic
1181230358 22:21417973-21417995 GAGGGGGCGAACGCGGGCGCAGG - Intronic
1183683643 22:39349820-39349842 CAGCGCGCGACCTCGGGCGCGGG - Intergenic
1203251301 22_KI270733v1_random:120067-120089 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
1203259346 22_KI270733v1_random:165141-165163 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
963808642 3:149752497-149752519 AGGCGCCGGGACACGGGCGCCGG - Exonic
973236845 4:47914652-47914674 AGTCGCCGGAACGCGGGCGGGGG - Intronic
996228048 5:121025910-121025932 AAGCACCTGAACGCTGGCCCTGG - Intergenic
997309247 5:132866336-132866358 AAGCGGCCGAATGCGGGAGGCGG - Intronic
997508137 5:134434603-134434625 AATCGCTTGAACGCGGGAGCTGG + Intergenic
1002592892 5:180303428-180303450 AAAGGCCCGGAGGCGGGCGCGGG + Intronic
1005472165 6:26172048-26172070 AACCTCCCGGACGCGCGCGCCGG - Intergenic
1007473405 6:42104826-42104848 CAGCTCCCGAACGCTGGCCCCGG - Exonic
1026665561 7:72337247-72337269 CGGCTCCTGAACGCGGGCGCCGG - Intronic
1035431979 7:158829378-158829400 GAGGGCCCGGAGGCGGGCGCCGG - Exonic
1039580948 8:38666559-38666581 AGGGGCCCGACAGCGGGCGCTGG - Intergenic
1052810104 9:33050737-33050759 AATCGCTCGAACCCGGGGGCCGG + Intronic
1053396423 9:37778426-37778448 AATCGCCTGAACCCGGGCGGCGG + Exonic
1058412350 9:104747807-104747829 AAGCGCCCTGACTCGGGCGCTGG + Exonic
1203467703 Un_GL000220v1:103218-103240 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
1203475528 Un_GL000220v1:147194-147216 AAGCGCTCGAACCCGGGAGGCGG - Intergenic
1185574173 X:1156944-1156966 AATCGCTCGAACGCGGGAGTCGG + Intergenic
1188541228 X:31252902-31252924 AATCGCTTGAACGCGGGCGGTGG + Intronic