ID: 1126140155

View in Genome Browser
Species Human (GRCh38)
Location 15:45430644-45430666
Sequence GGGAGACTCACCTGGACGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140155_1126140162 13 Left 1126140155 15:45430644-45430666 CCCGGCGTCCAGGTGAGTCTCCC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1126140162 15:45430680-45430702 CGGACGCGCCGGCCCGCAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 42
1126140155_1126140158 -7 Left 1126140155 15:45430644-45430666 CCCGGCGTCCAGGTGAGTCTCCC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1126140158 15:45430660-45430682 GTCTCCCATCTGCAGAGACGCGG 0: 1
1: 0
2: 0
3: 15
4: 162
1126140155_1126140168 30 Left 1126140155 15:45430644-45430666 CCCGGCGTCCAGGTGAGTCTCCC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1126140168 15:45430697-45430719 AGTTGGCCTGCGGAGCGCGGTGG 0: 1
1: 0
2: 0
3: 7
4: 90
1126140155_1126140167 27 Left 1126140155 15:45430644-45430666 CCCGGCGTCCAGGTGAGTCTCCC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1126140167 15:45430694-45430716 CGCAGTTGGCCTGCGGAGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 60
1126140155_1126140163 20 Left 1126140155 15:45430644-45430666 CCCGGCGTCCAGGTGAGTCTCCC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1126140163 15:45430687-45430709 GCCGGCCCGCAGTTGGCCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 126
1126140155_1126140161 2 Left 1126140155 15:45430644-45430666 CCCGGCGTCCAGGTGAGTCTCCC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1126140161 15:45430669-45430691 CTGCAGAGACGCGGACGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140155 Original CRISPR GGGAGACTCACCTGGACGCC GGG (reversed) Exonic
900799626 1:4729208-4729230 GGGAGACTCATCTGCATCCCGGG - Intronic
901659456 1:10789301-10789323 GGGAGGCTCAGCAGGAGGCCTGG - Intronic
902124120 1:14194288-14194310 GGGAGACTCAACTTGTCCCCTGG - Intergenic
902166898 1:14579785-14579807 GGGGGACTCACATGGCAGCCAGG + Intergenic
902559836 1:17270554-17270576 GGGAGGATCACCTGAACCCCAGG + Intronic
904062631 1:27723770-27723792 AGGAGAATCACCTGAACCCCTGG + Intergenic
904582073 1:31551604-31551626 GGGAGGATCACCTGAACCCCAGG - Intergenic
905288883 1:36907936-36907958 GGGTCACTCACCTGGGCCCCTGG + Intronic
906172846 1:43742230-43742252 TGGGGTCTCAGCTGGACGCCAGG - Intronic
909073050 1:71019405-71019427 GGGAGAGTCACGTGGAACCCAGG - Intronic
909994165 1:82258712-82258734 GGGAGGATCACCTGGAGGTCAGG + Intergenic
921050874 1:211510636-211510658 AGGAGAATCACTTGGACCCCTGG - Intergenic
923470084 1:234282552-234282574 GGGAGACACACCTGGTCGCTGGG - Intronic
1062767469 10:76484-76506 GGGAGACGCTCCGGGACACCTGG - Intergenic
1063944758 10:11165707-11165729 GCGACGCCCACCTGGACGCCTGG - Intronic
1064120427 10:12613568-12613590 AGGAGAATCACCTGCACCCCCGG - Intronic
1067790442 10:49283639-49283661 GGGAGACACAGCTGGAACCCAGG - Intergenic
1069834506 10:71300313-71300335 GGGAGATACATCTGGACTCCTGG + Exonic
1071596365 10:86930163-86930185 GGGAGAGTCACCTCGATGCTGGG + Exonic
1072737066 10:97886265-97886287 GTGATACTCCCCTGGAGGCCAGG - Intronic
1075705426 10:124497503-124497525 GGGAGCCCCACCCGGAGGCCTGG - Intronic
1075985864 10:126784592-126784614 GGGAGACTCACCAAGACTCCAGG + Intergenic
1076687490 10:132204636-132204658 GGCAGCCTCACCTGCACCCCGGG + Intronic
1077349611 11:2086385-2086407 GGGAGGCACACCTGGACCCCTGG - Intergenic
1077996136 11:7454059-7454081 GGGCGACTCACCTGGACTTAGGG - Intronic
1078103943 11:8346583-8346605 GGGAGCCTCAGGTGGAAGCCGGG - Intergenic
1078130694 11:8611829-8611851 GGGAGTCTCACCCTGTCGCCAGG - Intergenic
1078783185 11:14459706-14459728 AGGAGAATCACCTGAACCCCAGG - Intronic
1080626603 11:34036076-34036098 GGGAGACTCCCTTGAACCCCAGG + Intergenic
1082073766 11:47960834-47960856 GGGAGAATCACCTGAACCCAGGG - Intergenic
1083812211 11:65112319-65112341 GGGGGACTAAGATGGACGCCTGG + Intronic
1084213048 11:67632602-67632624 GAGAGAGTGACCTGGACTCCTGG - Exonic
1092042310 12:5395612-5395634 GGCAAACACACCTGGACGGCAGG - Intergenic
1094439306 12:30457146-30457168 GGGAGTCTCAGCTGGACTCCAGG + Intergenic
1095119596 12:38401228-38401250 GGGAGAATCACTTGAACCCCAGG - Intergenic
1096587173 12:52630313-52630335 GGGTCACCCACCTGCACGCCTGG + Intergenic
1098530572 12:71537225-71537247 GGGAGGATCACTTGGAGGCCAGG + Intronic
1099167135 12:79320712-79320734 AGGAGAATCACCTGAACCCCAGG - Intronic
1100852575 12:98728627-98728649 GTGAGACTCACTTGAACCCCGGG + Intronic
1104003211 12:124873665-124873687 GGGAGTGTCACCTGGAACCCGGG - Intronic
1113037118 13:106062389-106062411 GGCAGACTCTCCTGGAGGCATGG + Intergenic
1113425045 13:110200843-110200865 AGGAGTCTCACCTGGAGGTCCGG + Exonic
1115126973 14:30007558-30007580 GGGAGAATCACTTGGACCCAGGG - Intronic
1116583113 14:46667990-46668012 GGGAGATTCAGCTGGACACTTGG + Intergenic
1118219982 14:63846686-63846708 AGGAGAATCACCTGGAACCCAGG - Intergenic
1120766618 14:88333224-88333246 GGAAGAATCACCTGGTGGCCAGG - Intergenic
1122906446 14:104803776-104803798 TGCAGAGCCACCTGGACGCCTGG + Exonic
1126140155 15:45430644-45430666 GGGAGACTCACCTGGACGCCGGG - Exonic
1127430435 15:58902296-58902318 GGGAGAATCAGCTTGAGGCCAGG - Intronic
1128929548 15:71691816-71691838 GGGAGGCTCAGATGGACTCCAGG + Intronic
1130913218 15:88284978-88285000 GGGAGCCTGAGCTGGATGCCAGG - Intergenic
1132797267 16:1731235-1731257 AGGAGAATCACCTGAACCCCAGG + Intronic
1135557889 16:23452648-23452670 GGGAGTCTCAGCTGGGTGCCGGG - Intronic
1136414405 16:30095025-30095047 GGGAGTCTCAGCAGGATGCCAGG + Intronic
1136414645 16:30095967-30095989 CGGAGCCTTACCTGGACTCCGGG + Exonic
1136625094 16:31457552-31457574 AGGAGACTCACTTGAACCCCGGG - Intergenic
1141963879 16:87428002-87428024 AGGAGCATCACCTGGAGGCCAGG - Intronic
1143169464 17:4919260-4919282 AGGAGAATCACCTGAACCCCGGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145025692 17:19466368-19466390 AGGAGACTCACTTGAACCCCGGG + Intergenic
1146048615 17:29531669-29531691 GGGAGAATCACCTGAACCCCGGG + Intronic
1146790173 17:35746440-35746462 GGGAGACTCATCAGGCCGGCAGG + Intronic
1147164390 17:38585775-38585797 GGGAGACTCAACAGGGCGCTGGG - Intronic
1151872808 17:76848076-76848098 GGGAGAATCACTTGAACCCCGGG - Intergenic
1152194226 17:78907260-78907282 GGGAGGATCACCTTGAGGCCAGG - Intronic
1152248801 17:79200780-79200802 GGGGGATGCACCTGGACCCCTGG + Intronic
1152320265 17:79604959-79604981 AGGAGAAGCACCTGGACTCCAGG + Intergenic
1152405113 17:80093603-80093625 GGGAGAATCACTTGAACCCCGGG - Intronic
1152841122 17:82568917-82568939 GGGAGAATCACTTGAACCCCGGG + Intronic
1152960304 18:75830-75852 GGGAGACGCTCCGGGACACCTGG - Intergenic
1153469404 18:5427092-5427114 GGGAGAATCACCTGGGCCCAAGG - Intronic
1156213990 18:34977600-34977622 GGGAGCATCCCCTGGACCCCGGG + Intronic
1158743247 18:60167508-60167530 GGGAGAATCACCTGGGCCCAGGG + Intergenic
1161079573 19:2303812-2303834 GGGAGGCTGAACTGGACACCAGG + Intronic
1161698164 19:5781927-5781949 GGGAGGCTCACCTAGAGTCCAGG - Intergenic
1162041366 19:7972902-7972924 AGGAGAATCGCCTGGACCCCAGG - Intronic
1163008666 19:14411495-14411517 GAGGGACTCACCTTGACGCTGGG + Exonic
1163019831 19:14475959-14475981 GGGAGAGTCCCCAGGTCGCCAGG - Intergenic
1165899062 19:39160162-39160184 GGAAGTCTGACCTTGACGCCTGG - Intronic
1167819283 19:51911242-51911264 GGGAGTCTCACCTTGTTGCCTGG + Intronic
1168099939 19:54135840-54135862 GGGAGAATCACTTGAACCCCGGG + Intergenic
925832628 2:7910911-7910933 GGGAGACTCACGGTGACACCAGG + Intergenic
929599138 2:43194202-43194224 GGGAGATGCACCTGGCCCCCAGG + Intergenic
932217834 2:69978262-69978284 AGGAGACTCCCCTGGAGGCTTGG - Intergenic
935037382 2:99391821-99391843 GGGAGGATCACCTGAACCCCGGG - Intronic
936043827 2:109171002-109171024 GGGAGGCACACCTGCATGCCAGG + Intronic
938108687 2:128550227-128550249 GGGACAGTCACCTGGACATCCGG + Intergenic
939990986 2:148876348-148876370 GGGAGACACACCAGGCCTCCAGG - Intronic
940231412 2:151457212-151457234 GGGAGAATCACCTTGAGCCCAGG - Intronic
940647652 2:156408484-156408506 GGGAGACCGACCTGGATGCATGG + Intergenic
947529717 2:230901122-230901144 GGGAGACTTCCCTGAAGGCCAGG + Intergenic
947664447 2:231894836-231894858 CGGAGACTGACCTGGAGGCCAGG + Intergenic
948566548 2:238890938-238890960 GGTAGTCTCACCTGCACCCCGGG + Intronic
1171458734 20:25286680-25286702 GGGAGGCTCCTCTGGAGGCCAGG + Intronic
1172254085 20:33501663-33501685 GGGAGTCTCACTTTGTCGCCAGG + Intronic
1172303934 20:33868415-33868437 GGGAGACACAACTAGAAGCCTGG - Intergenic
1176292770 21:5055086-5055108 GGGAGGCTGACCTGGAGGGCAGG - Intergenic
1176429964 21:6569493-6569515 GGGAGACCCACCCTGACCCCCGG + Intergenic
1178602819 21:34009621-34009643 GCCAAACTCACCTGGAAGCCAGG + Intergenic
1179406703 21:41132268-41132290 TCGAGTCTCACCTGGACTCCGGG - Intergenic
1179643892 21:42763783-42763805 GGGAGGCTCAGCAGCACGCCTGG - Intronic
1179705358 21:43176955-43176977 GGGAGACCCACCCTGACCCCCGG + Intergenic
1179864490 21:44208564-44208586 GGGAGGCTGACCTGGAGGGCAGG + Intergenic
1180876513 22:19177610-19177632 GGGAGGGTCTCCTGGACGCCAGG - Intronic
1181562116 22:23711300-23711322 GGGAGAATCACCTGAGCCCCGGG + Intergenic
1182318098 22:29461136-29461158 GGGAGAATCACTTGAACCCCGGG + Intergenic
1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG + Exonic
1183140720 22:35936118-35936140 GGGAGAATCACTTGCACCCCAGG + Intronic
949874638 3:8618284-8618306 GGGAGAAACACCTGGAGGCTTGG - Intergenic
950291181 3:11785705-11785727 GGCAGAATCACCTGAACCCCGGG - Intergenic
953175382 3:40546964-40546986 GGCAGACACATCTGGAGGCCTGG + Intronic
953883170 3:46701829-46701851 GGGAGACTCACCTTGACCTTAGG + Intronic
954136816 3:48585679-48585701 GGGACACTCACCGGGAGGCCAGG + Exonic
954450958 3:50571524-50571546 GGGATAGACACCTGGAAGCCTGG + Intronic
956964924 3:74447805-74447827 GCAGGACTCACCTGGACCCCAGG + Intronic
957238690 3:77628988-77629010 GAGAGAGTCACATGGAAGCCAGG - Intronic
964672772 3:159245015-159245037 GGGAGTCTCACCAGGAAGCTGGG + Intronic
968137269 3:196228309-196228331 GGGAGCCTCTCCTGGACCCCTGG + Intronic
968611438 4:1558973-1558995 GGGAGACTCACGGGGACCCGGGG - Intergenic
969547969 4:7844386-7844408 GGCAGTCTAACCTGGACTCCCGG + Intronic
970618895 4:17796679-17796701 TGGAGACTCACCCTGTCGCCAGG - Intergenic
982265065 4:153530881-153530903 GGGAGTCTTTCCTGGAGGCCCGG + Intronic
983136452 4:164088644-164088666 GGGAGAATCACCTGAGCCCCAGG + Intronic
985589646 5:757872-757894 GGGGGACTCACATGGGGGCCAGG + Intronic
986813525 5:11384621-11384643 GCGCGACTCACCTGGGCGCGTGG - Intronic
987776323 5:22372345-22372367 GGGAGAAGCTCCTGGAGGCCAGG + Intronic
989773095 5:45168242-45168264 GGGACCCTCACCTGGACACTTGG + Intergenic
993725665 5:91363827-91363849 GGGAGAATCACCTGAGCCCCAGG - Intergenic
995469363 5:112484332-112484354 GGGAAGCTGACCTGGATGCCTGG + Intergenic
997456477 5:134021094-134021116 GGGAGGATCACCTGAACCCCGGG + Intergenic
997780360 5:136651960-136651982 AGCAGACTCACCTGGCAGCCAGG - Intergenic
999104968 5:149062960-149062982 GGGAAACTCACCTGGGCCCCGGG + Exonic
1000178463 5:158782815-158782837 AGTAGACTCACCTGGACTCATGG - Intronic
1001867587 5:175118762-175118784 GGGAGATTTATCTGGACCCCTGG - Intergenic
1002069708 5:176672052-176672074 AGGCGACCCACCTGGACGGCAGG + Intergenic
1006659405 6:35627367-35627389 GGGAGGGTCACTTAGACGCCAGG - Intronic
1009632339 6:66214860-66214882 GGGAGACCCACCTGCACACTGGG + Intergenic
1011946587 6:92912232-92912254 GGGAGACTGAACTTGACTCCTGG - Intergenic
1013285234 6:108675508-108675530 GGAAGTCTCACATGGACTCCAGG - Intronic
1014765875 6:125406236-125406258 GGGAGGCTCACCTGCACTCAGGG + Intergenic
1015440537 6:133241738-133241760 GGGTCACTCACCTCGTCGCCCGG - Exonic
1016041140 6:139432943-139432965 CAGAGTCTCACCTGGTCGCCAGG + Intergenic
1018176948 6:161185380-161185402 AGGAGAATCACCTGAACGCAGGG - Intronic
1019348764 7:543370-543392 GGGTGACTCACTTTGAGGCCAGG - Intergenic
1019492677 7:1322544-1322566 GGGAGGGACACCTGGACACCAGG - Intergenic
1024667693 7:51563026-51563048 AGGAGACTCACTTGAACCCCGGG - Intergenic
1026640881 7:72124410-72124432 GGGAGAATCACTTTGAGGCCAGG + Intronic
1026888405 7:73967946-73967968 AGGAGACCCACCTGGAGGCTGGG - Intergenic
1027201382 7:76065935-76065957 GCGACAAGCACCTGGACGCCAGG - Intronic
1029374689 7:100170587-100170609 GGGAGACACAGGTGGATGCCGGG + Intronic
1029604247 7:101589137-101589159 GGGAGGCACACCAGGACGCCGGG - Intergenic
1035381938 7:158445988-158446010 CGAAGGCTCACCTGGGCGCCCGG - Intronic
1035556167 8:568946-568968 GGGAGACTCACGGGCAGGCCGGG + Intergenic
1036064661 8:5366178-5366200 CGTTGACTCACCTGGATGCCTGG - Intergenic
1036492675 8:9242463-9242485 GGGAGAAACACCTGGAAGTCTGG - Intergenic
1037366795 8:18130995-18131017 AGGAGAATCACCTGAACCCCGGG + Intergenic
1038534289 8:28342938-28342960 TGGGGGATCACCTGGACGCCTGG - Exonic
1042647292 8:71001351-71001373 GGGAGAATCACCTGAACCCGGGG - Intergenic
1046087354 8:109454887-109454909 GGAAGACTCACCAGGACACCAGG + Intronic
1048472404 8:134714848-134714870 TGGAGGCTCTCCTGGAGGCCTGG - Intergenic
1051367280 9:16329997-16330019 GGGAGACACAGCTGGTCGGCAGG - Intergenic
1058734791 9:107884379-107884401 GGAAGACTCAACTGGAAGCATGG + Intergenic
1058847595 9:108976620-108976642 GGGAGAATCACCTGATCCCCAGG - Intronic
1061005212 9:127925096-127925118 GGGAGGCTCACCTGGCCGTGCGG + Exonic
1062270940 9:135708152-135708174 GGGGGACTCTCCTGGATGCAGGG + Intronic
1062600748 9:137317671-137317693 GGGGGAACCACCTGGACCCCTGG + Intronic
1062737796 9:138147884-138147906 GGGAGACGCTCCGGGACACCTGG + Intergenic
1195383676 X:104293913-104293935 GGGAGAATCACTTGAACCCCGGG - Intergenic
1195756360 X:108202917-108202939 GAGAGACTTACCGGGAAGCCTGG + Exonic
1197790697 X:130251187-130251209 GGGAGAATCACCTGAGCCCCAGG + Intronic
1197791223 X:130256038-130256060 GGGAGAATCACCTGAGCTCCAGG + Intronic
1198070413 X:133142972-133142994 GGGAGAATCACTTGGGTGCCAGG - Intergenic
1200068639 X:153517316-153517338 GGGAGACGCACCTAGAGGGCAGG + Intergenic
1200958205 Y:8972203-8972225 GTGAGACACCCCTGGACCCCAGG + Intergenic
1201379825 Y:13362993-13363015 GGGAGAATCACCTGAACCCAGGG - Intronic