ID: 1126140988

View in Genome Browser
Species Human (GRCh38)
Location 15:45438532-45438554
Sequence TTTCACATGTTGCCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 587}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140988_1126140994 12 Left 1126140988 15:45438532-45438554 CCAGCCCTGGGCAACATGTGAAA 0: 1
1: 0
2: 5
3: 86
4: 587
Right 1126140994 15:45438567-45438589 AAAAAATAAAAAAATTAGCTGGG 0: 425
1: 16123
2: 117165
3: 228072
4: 231335
1126140988_1126140995 17 Left 1126140988 15:45438532-45438554 CCAGCCCTGGGCAACATGTGAAA 0: 1
1: 0
2: 5
3: 86
4: 587
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302
1126140988_1126140993 11 Left 1126140988 15:45438532-45438554 CCAGCCCTGGGCAACATGTGAAA 0: 1
1: 0
2: 5
3: 86
4: 587
Right 1126140993 15:45438566-45438588 CAAAAAATAAAAAAATTAGCTGG 0: 313
1: 8683
2: 119993
3: 115210
4: 142125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140988 Original CRISPR TTTCACATGTTGCCCAGGGC TGG (reversed) Intronic