ID: 1126140989

View in Genome Browser
Species Human (GRCh38)
Location 15:45438536-45438558
Sequence AGGGTTTCACATGTTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 2, 2: 11, 3: 64, 4: 538}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140989_1126140996 29 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140996 15:45438588-45438610 GGTGTGGTGACGCATGCCTGTGG 0: 4
1: 149
2: 1109
3: 3008
4: 6521
1126140989_1126140993 7 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140993 15:45438566-45438588 CAAAAAATAAAAAAATTAGCTGG 0: 313
1: 8683
2: 119993
3: 115210
4: 142125
1126140989_1126140994 8 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140994 15:45438567-45438589 AAAAAATAAAAAAATTAGCTGGG 0: 425
1: 16123
2: 117165
3: 228072
4: 231335
1126140989_1126140995 13 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140989 Original CRISPR AGGGTTTCACATGTTGCCCA GGG (reversed) Intronic