ID: 1126140990

View in Genome Browser
Species Human (GRCh38)
Location 15:45438537-45438559
Sequence CAGGGTTTCACATGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5955
Summary {0: 12, 1: 131, 2: 393, 3: 1208, 4: 4211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140990_1126140995 12 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302
1126140990_1126140993 6 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140993 15:45438566-45438588 CAAAAAATAAAAAAATTAGCTGG 0: 313
1: 8683
2: 119993
3: 115210
4: 142125
1126140990_1126140994 7 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140994 15:45438567-45438589 AAAAAATAAAAAAATTAGCTGGG 0: 425
1: 16123
2: 117165
3: 228072
4: 231335
1126140990_1126140996 28 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140996 15:45438588-45438610 GGTGTGGTGACGCATGCCTGTGG 0: 4
1: 149
2: 1109
3: 3008
4: 6521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140990 Original CRISPR CAGGGTTTCACATGTTGCCC AGG (reversed) Intronic