ID: 1126140991

View in Genome Browser
Species Human (GRCh38)
Location 15:45438555-45438577
Sequence TTTTATTTTTTGTAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583853
Summary {0: 1209, 1: 9840, 2: 93675, 3: 221670, 4: 257459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140991_1126140998 21 Left 1126140991 15:45438555-45438577 CCCTGTCTCTACAAAAAATAAAA 0: 1209
1: 9840
2: 93675
3: 221670
4: 257459
Right 1126140998 15:45438599-45438621 GCATGCCTGTGGTGCTATTCGGG 0: 1
1: 0
2: 0
3: 17
4: 135
1126140991_1126140995 -6 Left 1126140991 15:45438555-45438577 CCCTGTCTCTACAAAAAATAAAA 0: 1209
1: 9840
2: 93675
3: 221670
4: 257459
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302
1126140991_1126140996 10 Left 1126140991 15:45438555-45438577 CCCTGTCTCTACAAAAAATAAAA 0: 1209
1: 9840
2: 93675
3: 221670
4: 257459
Right 1126140996 15:45438588-45438610 GGTGTGGTGACGCATGCCTGTGG 0: 4
1: 149
2: 1109
3: 3008
4: 6521
1126140991_1126140997 20 Left 1126140991 15:45438555-45438577 CCCTGTCTCTACAAAAAATAAAA 0: 1209
1: 9840
2: 93675
3: 221670
4: 257459
Right 1126140997 15:45438598-45438620 CGCATGCCTGTGGTGCTATTCGG 0: 1
1: 0
2: 0
3: 9
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140991 Original CRISPR TTTTATTTTTTGTAGAGACA GGG (reversed) Intronic