ID: 1126140993

View in Genome Browser
Species Human (GRCh38)
Location 15:45438566-45438588
Sequence CAAAAAATAAAAAAATTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386324
Summary {0: 313, 1: 8683, 2: 119993, 3: 115210, 4: 142125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140988_1126140993 11 Left 1126140988 15:45438532-45438554 CCAGCCCTGGGCAACATGTGAAA 0: 1
1: 0
2: 5
3: 86
4: 587
Right 1126140993 15:45438566-45438588 CAAAAAATAAAAAAATTAGCTGG 0: 313
1: 8683
2: 119993
3: 115210
4: 142125
1126140990_1126140993 6 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140993 15:45438566-45438588 CAAAAAATAAAAAAATTAGCTGG 0: 313
1: 8683
2: 119993
3: 115210
4: 142125
1126140989_1126140993 7 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140993 15:45438566-45438588 CAAAAAATAAAAAAATTAGCTGG 0: 313
1: 8683
2: 119993
3: 115210
4: 142125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140993 Original CRISPR CAAAAAATAAAAAAATTAGC TGG Intronic