ID: 1126140994

View in Genome Browser
Species Human (GRCh38)
Location 15:45438567-45438589
Sequence AAAAAATAAAAAAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593120
Summary {0: 425, 1: 16123, 2: 117165, 3: 228072, 4: 231335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140989_1126140994 8 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140994 15:45438567-45438589 AAAAAATAAAAAAATTAGCTGGG 0: 425
1: 16123
2: 117165
3: 228072
4: 231335
1126140990_1126140994 7 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140994 15:45438567-45438589 AAAAAATAAAAAAATTAGCTGGG 0: 425
1: 16123
2: 117165
3: 228072
4: 231335
1126140988_1126140994 12 Left 1126140988 15:45438532-45438554 CCAGCCCTGGGCAACATGTGAAA 0: 1
1: 0
2: 5
3: 86
4: 587
Right 1126140994 15:45438567-45438589 AAAAAATAAAAAAATTAGCTGGG 0: 425
1: 16123
2: 117165
3: 228072
4: 231335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140994 Original CRISPR AAAAAATAAAAAAATTAGCT GGG Intronic