ID: 1126140995

View in Genome Browser
Species Human (GRCh38)
Location 15:45438572-45438594
Sequence ATAAAAAAATTAGCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377606
Summary {0: 386, 1: 23583, 2: 61864, 3: 128471, 4: 163302}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140991_1126140995 -6 Left 1126140991 15:45438555-45438577 CCCTGTCTCTACAAAAAATAAAA 0: 1209
1: 9840
2: 93675
3: 221670
4: 257459
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302
1126140988_1126140995 17 Left 1126140988 15:45438532-45438554 CCAGCCCTGGGCAACATGTGAAA 0: 1
1: 0
2: 5
3: 86
4: 587
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302
1126140990_1126140995 12 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302
1126140989_1126140995 13 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302
1126140992_1126140995 -7 Left 1126140992 15:45438556-45438578 CCTGTCTCTACAAAAAATAAAAA 0: 1205
1: 14690
2: 212366
3: 268082
4: 182877
Right 1126140995 15:45438572-45438594 ATAAAAAAATTAGCTGGGTGTGG 0: 386
1: 23583
2: 61864
3: 128471
4: 163302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140995 Original CRISPR ATAAAAAAATTAGCTGGGTG TGG Intronic