ID: 1126140996

View in Genome Browser
Species Human (GRCh38)
Location 15:45438588-45438610
Sequence GGTGTGGTGACGCATGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10791
Summary {0: 4, 1: 149, 2: 1109, 3: 3008, 4: 6521}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126140991_1126140996 10 Left 1126140991 15:45438555-45438577 CCCTGTCTCTACAAAAAATAAAA 0: 1209
1: 9840
2: 93675
3: 221670
4: 257459
Right 1126140996 15:45438588-45438610 GGTGTGGTGACGCATGCCTGTGG 0: 4
1: 149
2: 1109
3: 3008
4: 6521
1126140990_1126140996 28 Left 1126140990 15:45438537-45438559 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 1126140996 15:45438588-45438610 GGTGTGGTGACGCATGCCTGTGG 0: 4
1: 149
2: 1109
3: 3008
4: 6521
1126140992_1126140996 9 Left 1126140992 15:45438556-45438578 CCTGTCTCTACAAAAAATAAAAA 0: 1205
1: 14690
2: 212366
3: 268082
4: 182877
Right 1126140996 15:45438588-45438610 GGTGTGGTGACGCATGCCTGTGG 0: 4
1: 149
2: 1109
3: 3008
4: 6521
1126140989_1126140996 29 Left 1126140989 15:45438536-45438558 CCCTGGGCAACATGTGAAACCCT 0: 1
1: 2
2: 11
3: 64
4: 538
Right 1126140996 15:45438588-45438610 GGTGTGGTGACGCATGCCTGTGG 0: 4
1: 149
2: 1109
3: 3008
4: 6521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126140996 Original CRISPR GGTGTGGTGACGCATGCCTG TGG Intronic