ID: 1126142591

View in Genome Browser
Species Human (GRCh38)
Location 15:45450224-45450246
Sequence CTGTGGATGAGAAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126142578_1126142591 23 Left 1126142578 15:45450178-45450200 CCCTGCCTGGAAGAGGCCTATCA No data
Right 1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG No data
1126142583_1126142591 -6 Left 1126142583 15:45450207-45450229 CCAAGCTTTGCTCCCACCTGTGG No data
Right 1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG No data
1126142581_1126142591 18 Left 1126142581 15:45450183-45450205 CCTGGAAGAGGCCTATCAGGTTG No data
Right 1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG No data
1126142579_1126142591 22 Left 1126142579 15:45450179-45450201 CCTGCCTGGAAGAGGCCTATCAG No data
Right 1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG No data
1126142577_1126142591 28 Left 1126142577 15:45450173-45450195 CCTGTCCCTGCCTGGAAGAGGCC No data
Right 1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG No data
1126142582_1126142591 7 Left 1126142582 15:45450194-45450216 CCTATCAGGTTGACCAAGCTTTG No data
Right 1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126142591 Original CRISPR CTGTGGATGAGAAGGGCAGG TGG Intergenic
No off target data available for this crispr