ID: 1126146362

View in Genome Browser
Species Human (GRCh38)
Location 15:45476415-45476437
Sequence AAGAATATTTTCCAAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126146362_1126146364 2 Left 1126146362 15:45476415-45476437 CCTGGACTTTGGAAAATATTCTT No data
Right 1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG No data
1126146362_1126146363 -2 Left 1126146362 15:45476415-45476437 CCTGGACTTTGGAAAATATTCTT No data
Right 1126146363 15:45476436-45476458 TTATATAAAGAAGCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126146362 Original CRISPR AAGAATATTTTCCAAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr