ID: 1126147301

View in Genome Browser
Species Human (GRCh38)
Location 15:45487862-45487884
Sequence GAACATTTAGAGATGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126147301_1126147303 -6 Left 1126147301 15:45487862-45487884 CCTTGTGCCATCTCTAAATGTTC 0: 1
1: 0
2: 0
3: 13
4: 202
Right 1126147303 15:45487879-45487901 ATGTTCTAGAATATCAGAGCTGG 0: 1
1: 0
2: 1
3: 27
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126147301 Original CRISPR GAACATTTAGAGATGGCACA AGG (reversed) Intronic
902932924 1:19744023-19744045 AAACATTTAGAGGTGTCACCAGG - Intronic
902944099 1:19821853-19821875 GAAAGTTTAGAGATGGCAGTGGG - Intergenic
904649155 1:31991376-31991398 GAACAGTTAGAGACAGCTCATGG - Intergenic
906049970 1:42862959-42862981 GAACATTTGGAGAGCTCACAAGG + Intergenic
908073016 1:60484414-60484436 GAACATTTTGAGATGGTAGCAGG - Intergenic
908927938 1:69279147-69279169 GAACATTTAAAGATAGAAAAAGG + Intergenic
909147283 1:71952086-71952108 GAACATTTAGAGATCGCTGTAGG - Intronic
909397311 1:75184896-75184918 AAACAATTAGAAATGGCAAAGGG + Intergenic
909686143 1:78351130-78351152 GAACATAAAGAGAGGGCAGAAGG + Intronic
910721492 1:90291434-90291456 TAACATTAAGAGATGGCAGTGGG - Intergenic
911045564 1:93624643-93624665 GAACATTTGGAGATAGCTCAGGG + Intronic
912378592 1:109233519-109233541 CAAAATTTAGAAATGGCAGAGGG + Intronic
913136884 1:115899559-115899581 AAACACTTAGAGATAGTACATGG - Intergenic
914045506 1:144088348-144088370 AAAAATTTGGAGATGGGACAGGG - Intergenic
914132604 1:144872337-144872359 AAAAATTTGGAGATGGGACAGGG + Intergenic
915582362 1:156822169-156822191 GAACATAATGAGAGGGCACAGGG - Intronic
918790190 1:188814927-188814949 TAACATTAACAGATGGCACTTGG - Intergenic
918983187 1:191590103-191590125 GAACATTTAGATAGAACACAAGG + Intergenic
919400112 1:197103673-197103695 AAAGATTCAGAGATGGTACAGGG - Exonic
919612045 1:199757641-199757663 CATCATTTCAAGATGGCACAAGG + Intergenic
922392642 1:225161783-225161805 GAAGACTTAGAAATGGCAAATGG - Intronic
922640008 1:227220647-227220669 AAACATTTAGAGTTGGCATGAGG - Intronic
1063943883 10:11158405-11158427 GAACTTTTAGAAATGGCAACAGG - Intronic
1064417878 10:15166691-15166713 CAAAATTTAGAGATGCCCCATGG - Intronic
1067149093 10:43714937-43714959 CAAACCTTAGAGATGGCACAGGG + Intergenic
1069939881 10:71948123-71948145 GAACAGGTAGAGGTGGGACAAGG - Intergenic
1071206065 10:83279847-83279869 GAAAAATTAGAAAGGGCACATGG + Intergenic
1072677897 10:97482209-97482231 GAGCATTTAAAAATGGAACAAGG + Intronic
1078966836 11:16354851-16354873 GAACATTTAGTGTTGGGCCAGGG - Intronic
1079325213 11:19485577-19485599 GAATATTTAAATATGGCACCAGG + Intronic
1081243168 11:40731415-40731437 GAACATTTACTTATGGCAGAAGG - Intronic
1087075778 11:94126228-94126250 GGACATTCAGAGCTGGGACAGGG - Intergenic
1087488238 11:98787043-98787065 GAGCATTTAGATATGGCTCAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090600363 11:128363604-128363626 GAGGATTTAGAGAATGCACAAGG - Intergenic
1093576316 12:20734427-20734449 GGACAGTTAAAGATGGCACTGGG - Intronic
1093827860 12:23716900-23716922 GTACCTTGAGAGAGGGCACATGG - Intronic
1094315168 12:29131663-29131685 CCACATTGTGAGATGGCACATGG + Intergenic
1095336362 12:41032548-41032570 GAACAAGTAGAGATGCCTCAAGG - Intronic
1096961764 12:55586068-55586090 AAACATTTAGAGATCGCAAGTGG + Intergenic
1099321540 12:81156903-81156925 AAACATTAGTAGATGGCACATGG - Intronic
1101271390 12:103149446-103149468 GGACATTTACAGAAGGCAAAGGG - Intergenic
1101914874 12:108888249-108888271 GAACCTTGAGAGCTGGCACGGGG - Intronic
1102612763 12:114127276-114127298 GAAAACTTAGAGAAAGCACAGGG + Intergenic
1104411241 12:128559847-128559869 GAGAATTTAGAGAAGACACAAGG - Intronic
1105800649 13:23900486-23900508 GAACATTGAGGGTTTGCACAAGG + Intronic
1106903886 13:34384747-34384769 GAACATTGGCAGATGGAACAAGG + Intergenic
1107251521 13:38369093-38369115 GAACATTAAGGGAAGGCATATGG + Intergenic
1108451599 13:50572121-50572143 AAACATTAAGAGATTTCACACGG + Intronic
1108520977 13:51246813-51246835 TAACTGATAGAGATGGCACAGGG + Intronic
1108831004 13:54478262-54478284 GAACAGCTAGAGAAGGCAAAAGG + Intergenic
1111773497 13:92628705-92628727 GAACACTTGGAGAAGGCAGATGG - Intronic
1115862877 14:37709099-37709121 GATCATTGAGAAATGGCAGATGG - Intronic
1116293705 14:43075944-43075966 GAAAATTTAGACATCTCACATGG - Intergenic
1118057705 14:62098971-62098993 GAACATGTACAGATGAGACAGGG + Intronic
1122135018 14:99627833-99627855 GAACATTTGGAGATGACAAGTGG + Intergenic
1125394849 15:39235663-39235685 AAACTTTTAGACATGGCAGAAGG - Intergenic
1126147301 15:45487862-45487884 GAACATTTAGAGATGGCACAAGG - Intronic
1127326267 15:57898045-57898067 AAACATTGAGAAATAGCACATGG + Intergenic
1128623886 15:69179567-69179589 GACTATATAGGGATGGCACAGGG - Intronic
1131504477 15:93004402-93004424 GTACATTTAGAGATGGAAATGGG + Intronic
1131816368 15:96225104-96225126 GAACATTTGAAAATGACACAAGG + Intergenic
1131961903 15:97798638-97798660 GAACATTCAGAGAAGTCTCATGG + Intergenic
1132092035 15:98954878-98954900 GAACAGTCACAGATGTCACAGGG - Intronic
1133546554 16:6813404-6813426 GAACATTCAGAGGTGACACCTGG - Intronic
1134506742 16:14813824-14813846 GAACATTTAGATAAGGCAGAAGG - Intronic
1134573816 16:15314997-15315019 GAACATTTAGATAAGGCAGAAGG + Intergenic
1134728604 16:16441321-16441343 GAACATTTAGATAAGGCAGAAGG - Intergenic
1134938838 16:18270597-18270619 GAACATTTAGATAAGGCAGAAGG + Intergenic
1135466492 16:22690766-22690788 GAAGATTAAGTGATGACACATGG - Intergenic
1135479607 16:22812173-22812195 AAACATTTAGAGATGTTACTTGG + Intergenic
1135843661 16:25898635-25898657 GACCTTATAGAGATGGCAAAGGG - Intronic
1137620082 16:49870231-49870253 GAACTTTCAGAGAAGCCACAGGG + Intergenic
1137856477 16:51799308-51799330 GACCATTTTCAGAGGGCACAGGG + Intergenic
1140607487 16:76557805-76557827 GGACACTTTGAGAGGGCACAGGG - Intronic
1141740112 16:85885441-85885463 GAACATTTCGAGGTAGCACTAGG + Intergenic
1142649367 17:1337221-1337243 GAAAATATAGAGATGGCAAATGG + Intergenic
1143971331 17:10798130-10798152 TGACAAGTAGAGATGGCACAGGG - Intergenic
1146653779 17:34623310-34623332 GAACAGTAAGAGAGGGCAAAGGG + Intronic
1149376375 17:56048011-56048033 AAAGATTGGGAGATGGCACAGGG - Intergenic
1153077889 18:1186426-1186448 GAACTTTTACAGATCCCACATGG - Intergenic
1153120093 18:1712838-1712860 GCACATTTAGATGTGCCACAGGG + Intergenic
1156976932 18:43233902-43233924 GAACACACAGAGATGGCAGAAGG - Intergenic
1157235605 18:45962253-45962275 AATCATTTAGGCATGGCACAAGG + Intronic
1157781379 18:50442619-50442641 GAATACTTAGAGATGGATCAGGG + Intergenic
1157815801 18:50728889-50728911 GAACAGTGAGTGCTGGCACATGG + Intronic
1158928720 18:62299077-62299099 GAATATTGAGAGAAGGCGCAGGG - Intronic
1159102485 18:63971251-63971273 GAACATCTAGTGGAGGCACAAGG - Intronic
1160217636 18:76947009-76947031 GAACATGGAGTGATGGCTCATGG - Intronic
1160475584 18:79182859-79182881 GAACATCTAAAGGTGGCAGAAGG - Intronic
1164274239 19:23702705-23702727 GAACCTTTAGAGGTGACAGAAGG - Intergenic
1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG + Intergenic
1202685065 1_KI270712v1_random:41756-41778 AAAAATTTGGAGATGGGACAGGG - Intergenic
925634502 2:5929929-5929951 GAACAAATAGAGATGGAATAGGG + Intergenic
926821628 2:16857772-16857794 GAACATTTATACATTGCTCATGG - Intergenic
927332150 2:21878219-21878241 GAAAATATAGAGAAGCCACATGG - Intergenic
928007523 2:27577047-27577069 GAATCTTCAGAAATGGCACAAGG + Exonic
928338176 2:30416928-30416950 GGACATTCAGAGATGGCATGAGG - Intergenic
928550741 2:32368044-32368066 GAAGACTGGGAGATGGCACAGGG + Intronic
930402085 2:50903217-50903239 GAACATAAAGAGATTGCAAAGGG - Intronic
931448050 2:62343502-62343524 GAATATTTAGAGAAGTGACAAGG - Intergenic
931928844 2:67106161-67106183 GAAGATTGAGAGAAGGCATATGG - Intergenic
934246654 2:90313101-90313123 AAAAATTTGGAGATGGGACAGGG + Intergenic
939625272 2:144469075-144469097 GAACCTTTGGTGCTGGCACATGG + Intronic
940879726 2:158934843-158934865 GAGCATTTAGAAATGGGACTGGG - Intergenic
943477231 2:188372657-188372679 TAACAATTAGATATGTCACATGG - Intronic
943577620 2:189649398-189649420 CAACATTTAGAGATTGGATAGGG + Intergenic
944394889 2:199255461-199255483 AAACATTAAGAAATGGAACAAGG + Intergenic
944803259 2:203256957-203256979 GGAAGTTTAGAGATGGTACATGG - Intronic
946510003 2:220345780-220345802 TATCATTTAGAAATGGCAGAAGG + Intergenic
947825184 2:233100927-233100949 GAACACTGAAAGATGGCAAAGGG - Intronic
1170884956 20:20332419-20332441 GAACATATTGAGATGGCAGTTGG - Intronic
1170942056 20:20856244-20856266 GAACATTTCTAGATGCCTCATGG - Intergenic
1174726632 20:52869415-52869437 GTGCATTCAGAGACGGCACATGG + Intergenic
1177372632 21:20223480-20223502 GAACATTCAGTGATGGCATCTGG - Intergenic
1179928991 21:44554770-44554792 CCACATTTAAAGATGGCAGAAGG - Intronic
1181487044 22:23238095-23238117 GAACATTGAGAGATGAAACGAGG + Intronic
1182832616 22:33315948-33315970 GAGCAGGAAGAGATGGCACATGG - Intronic
949120339 3:376353-376375 GTACATTTGGAGATGGGGCAAGG - Intronic
950107183 3:10395747-10395769 AAACATTGAGAGCTGGTACAGGG + Intronic
950316051 3:12003353-12003375 CAAGATTTAGAGAGTGCACATGG + Intergenic
951110453 3:18797636-18797658 GTATATTGGGAGATGGCACAAGG - Intergenic
951255502 3:20444974-20444996 GAAGATATAGAAATGGCAAACGG + Intergenic
951306920 3:21075365-21075387 GAACATTTAGAAATGTCTTATGG + Intergenic
952289056 3:31997688-31997710 GAACATCTGGAGATGGGAGATGG + Intronic
953138812 3:40208621-40208643 CAAGATTTTGAGATGGTACAAGG - Intronic
955887365 3:63614783-63614805 GATTATTTCCAGATGGCACAGGG - Intronic
957141754 3:76368581-76368603 GAGCATTTAGACATCTCACATGG + Intronic
959807644 3:110576520-110576542 AAATATTTACAGATGGCACCAGG - Intergenic
961183332 3:124893540-124893562 GAACTCTGAGAGCTGGCACAGGG - Intronic
962214951 3:133513170-133513192 TAATATTAAGAGATGGCCCAAGG - Intergenic
962912693 3:139868635-139868657 GAACTTTTATTGATGGCTCAGGG + Intergenic
965499352 3:169439016-169439038 GTTCATTTAGAGATAGCATAAGG + Intronic
965499359 3:169439236-169439258 GTTCATTTAGAGATAGCATAAGG + Intronic
967071119 3:185963133-185963155 GAACATGGAGAGAAGGCAAATGG - Intergenic
967645098 3:191913204-191913226 GAAGATTCAGAGTTGGCTCAAGG - Intergenic
967785134 3:193485039-193485061 GAACATTTCGATATGTCACCTGG - Intronic
970965277 4:21921286-21921308 TAACATTTAGAGATAGAGCAAGG - Intronic
971803689 4:31326847-31326869 ACACATTTACAGATTGCACATGG + Intergenic
972753628 4:42020538-42020560 GATTATTTAGATATGACACACGG - Intronic
976832731 4:89333361-89333383 GAACATTGAGTGCTGACACAAGG + Intergenic
979036979 4:115733089-115733111 GAACATTTTGAGAGAGAACATGG - Intergenic
979377035 4:119958840-119958862 GAGAATTCAGAGAGGGCACAGGG - Intergenic
981017291 4:139987437-139987459 GAACATTCAGTGATGACGCACGG - Intronic
983310382 4:166052878-166052900 GAACATTTCCAGATGGCCAAAGG - Intronic
986467427 5:8039755-8039777 AAACAATTAGAGATGACAAAGGG - Intergenic
986671726 5:10148569-10148591 GAACAGAAAGAGATGGCACCTGG + Intergenic
991235765 5:64395098-64395120 CCATATTTACAGATGGCACATGG + Intergenic
991685418 5:69177678-69177700 TAATATGTACAGATGGCACATGG - Exonic
994349433 5:98727462-98727484 AAACATTCTGAGAAGGCACATGG - Intergenic
994465323 5:100121208-100121230 GAACATTTAGATATAGAACGGGG - Intergenic
994687354 5:102971681-102971703 AAACATTGAGAGATGACACAGGG + Intronic
996421977 5:123272207-123272229 GGACAGTTGTAGATGGCACATGG + Intergenic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997689038 5:135813186-135813208 GAACCTTGGGAGATGGCAGAGGG - Intergenic
998791354 5:145768869-145768891 GAACAGTTAGAAATGGAACATGG + Intronic
999049564 5:148507622-148507644 GACAATTTAGAGATGGCATATGG - Intronic
1000146498 5:158458260-158458282 TCACATCTGGAGATGGCACAAGG + Intergenic
1001982349 5:176045919-176045941 GAAGATCTGGAGATGGCACTGGG - Intergenic
1002235112 5:177798138-177798160 GAAGATCTGGAGATGGCACTGGG + Intergenic
1002993336 6:2258204-2258226 GAACAGATGGAGATGACACAAGG - Intergenic
1005349904 6:24923958-24923980 GCACATTTAGAGGGGCCACATGG - Intronic
1007957073 6:45927720-45927742 AAACTTTTAGAGATGTGACAAGG - Intronic
1010487481 6:76432825-76432847 GAACATTGAGAGAAGGCCCCAGG - Intergenic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1013680288 6:112517839-112517861 GAAGATTTAGGGATAGCAAAAGG + Intergenic
1014141263 6:117945862-117945884 GAACTTTTAGAGATGGGTCTCGG + Intronic
1014512829 6:122345548-122345570 GAACAGGAAGAGATGGCACCTGG - Intergenic
1015158682 6:130126767-130126789 GAACCTTCAGAGAAGGCAGAGGG - Intronic
1015294955 6:131580296-131580318 GAAATTTTAGGAATGGCACATGG + Intronic
1018234748 6:161713262-161713284 GAACATGTAGAGATGCTGCAAGG - Intronic
1019838742 7:3417279-3417301 GAACAAATAGAGGTGGGACATGG + Intronic
1020772967 7:12418963-12418985 GGAAACTTAGAGATGGCATATGG + Intergenic
1022407885 7:30109094-30109116 GAACAATTAGAGATGACTAACGG - Intronic
1023485019 7:40676999-40677021 GAACATTTAGAAAACTCACATGG - Intronic
1027180778 7:75937871-75937893 CAACATTAAAAGGTGGCACAAGG - Intronic
1030311222 7:108071298-108071320 TAACATTTAGGGATGGGATAGGG - Intronic
1031388873 7:121188626-121188648 TAACATTTAGAGATGGGGAAAGG + Intronic
1032428377 7:131840347-131840369 GAACTTTTAGAGAGGGGGCAGGG + Intergenic
1032564271 7:132925462-132925484 TAACATTTAAAGTTGGCACCTGG - Intronic
1033734275 7:144206729-144206751 GAACATTGAGAGAAAGAACAGGG + Intergenic
1033748776 7:144344240-144344262 GAACATTGAGAGAAAGAACAGGG - Intergenic
1035928955 8:3760231-3760253 GCTCCTTTAGAGATGGCAAAAGG + Intronic
1037462308 8:19123673-19123695 GAAGATTTACAGATGGCAAATGG - Intergenic
1038118523 8:24585234-24585256 GAAGACTTAGGGATGGCAAAAGG + Intergenic
1039150610 8:34500919-34500941 ATTCATTTAGAAATGGCACATGG + Intergenic
1039958924 8:42229709-42229731 CAGCATTTACAGATTGCACATGG + Intergenic
1040430625 8:47338240-47338262 GAAGATTTCAAGATGGGACATGG + Intronic
1041247149 8:55899524-55899546 GAACATTTATTGAGTGCACACGG + Intronic
1044399069 8:91749107-91749129 GAATACCTAGAGATTGCACAAGG + Intergenic
1044471468 8:92574036-92574058 GAACATTTATAAAGGCCACAAGG - Intergenic
1045297511 8:100884949-100884971 GAACATTTTAAAATTGCACATGG + Intergenic
1046834262 8:118782102-118782124 AATCAATTAGAGATGGCAGAGGG - Intergenic
1047343780 8:124007622-124007644 GAATATTTAAAGATGGCAGTTGG - Intronic
1048218386 8:132517835-132517857 GAACATTTTGAGATTTCATAAGG + Intergenic
1048276071 8:133067088-133067110 GAAAAATAAGAGCTGGCACAGGG + Intronic
1049874333 8:145006163-145006185 GAACATTCAGATATGCTACAGGG + Intergenic
1051089400 9:13388338-13388360 GATGAATCAGAGATGGCACAAGG + Intergenic
1051179778 9:14398342-14398364 GAACTTTCAGAGCTGGCATAAGG - Intronic
1052620666 9:30905174-30905196 GAAGATGTAGAGATGGTACCTGG + Intergenic
1053245632 9:36532507-36532529 AAACACCTAGAGGTGGCACAGGG - Intergenic
1053404028 9:37855296-37855318 CAAAAATTAGTGATGGCACAAGG + Intronic
1053904033 9:42823286-42823308 GAACATTTATGGAAAGCACATGG - Intergenic
1055027982 9:71742795-71742817 GTACATTAAGAGATGGATCAAGG + Intronic
1058977875 9:110141420-110141442 GAACATTTAAAGCAGGCACCCGG + Intronic
1060060001 9:120450934-120450956 GAACAGTTTGAGGTGGCAAAAGG + Intronic
1185952031 X:4448120-4448142 GAAGATTGAGAGATGACAGACGG + Intergenic
1186259126 X:7757032-7757054 GAACTTGGAGAGATGACACAGGG - Intergenic
1188287448 X:28344867-28344889 GGACATAAAGAGATGGCTCATGG - Intergenic
1189716791 X:43875283-43875305 GCACATTTAGAGAGTGCAAAGGG - Intronic
1194790514 X:98142862-98142884 GAATCTTTAGAGGTGGCACAAGG + Intergenic
1195502255 X:105615043-105615065 GAAGATATACAAATGGCACATGG + Intronic
1196430792 X:115623069-115623091 GAAAATGTATACATGGCACATGG + Intronic
1199342069 X:146692613-146692635 GAACAAATAGAGAAGGCACCAGG - Intergenic
1199412402 X:147539458-147539480 GAGGATTCAGAGATGCCACATGG + Intergenic
1201603623 Y:15760452-15760474 GAACTTGGAGAGATGACACAAGG + Intergenic