ID: 1126153889

View in Genome Browser
Species Human (GRCh38)
Location 15:45547395-45547417
Sequence CAGCGAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126153880_1126153889 24 Left 1126153880 15:45547348-45547370 CCCTGCCGGATCTGGAGGGGGGG No data
Right 1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG No data
1126153883_1126153889 19 Left 1126153883 15:45547353-45547375 CCGGATCTGGAGGGGGGGAAGTC No data
Right 1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG No data
1126153882_1126153889 23 Left 1126153882 15:45547349-45547371 CCTGCCGGATCTGGAGGGGGGGA No data
Right 1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126153889 Original CRISPR CAGCGAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr