ID: 1126158534

View in Genome Browser
Species Human (GRCh38)
Location 15:45587430-45587452
Sequence GACACTCATGTCCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126158534_1126158544 13 Left 1126158534 15:45587430-45587452 CCAGCTGGAGGGACATGAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1126158544 15:45587466-45587488 CTCCGGACGGGGCCCTGACACGG 0: 1
1: 0
2: 3
3: 3
4: 82
1126158534_1126158548 29 Left 1126158534 15:45587430-45587452 CCAGCTGGAGGGACATGAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1126158548 15:45587482-45587504 GACACGGCCACCCTACTGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1126158534_1126158540 0 Left 1126158534 15:45587430-45587452 CCAGCTGGAGGGACATGAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1126158540 15:45587453-45587475 CCTGGGCCGTCGTCTCCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 97
1126158534_1126158542 2 Left 1126158534 15:45587430-45587452 CCAGCTGGAGGGACATGAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1126158542 15:45587455-45587477 TGGGCCGTCGTCTCCGGACGGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1126158534_1126158541 1 Left 1126158534 15:45587430-45587452 CCAGCTGGAGGGACATGAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1126158541 15:45587454-45587476 CTGGGCCGTCGTCTCCGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1126158534_1126158537 -4 Left 1126158534 15:45587430-45587452 CCAGCTGGAGGGACATGAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1126158537 15:45587449-45587471 TGTCCCTGGGCCGTCGTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126158534 Original CRISPR GACACTCATGTCCCTCCAGC TGG (reversed) Exonic
900405576 1:2491558-2491580 GGCAATCATGTCCCCCCAGCTGG - Intronic
901063522 1:6484737-6484759 GACCCTGGTGTCCCTCCTGCAGG - Intronic
902086366 1:13866033-13866055 GAGCCTCAGTTCCCTCCAGCTGG + Intergenic
904110327 1:28121294-28121316 GGCACTCATCTCCCGCCTGCTGG - Intergenic
911753598 1:101527006-101527028 GTCTCTCATGTTCCTCCATCAGG - Intergenic
912798260 1:112705837-112705859 GCCACTGCTGTCCCCCCAGCAGG + Exonic
913161241 1:116147909-116147931 GCCACTCAGGTCCCTCCGGATGG + Intergenic
916682596 1:167117791-167117813 GACTCTCTTGTCCCTCAAGAAGG + Intronic
917538488 1:175891671-175891693 ATCACACATGTCCATCCAGCAGG - Intergenic
918928321 1:190816913-190816935 GATACTGATGTACCTACAGCTGG - Intergenic
920514314 1:206573383-206573405 CACACTCATGTTCATCCTGCAGG + Intronic
921229268 1:213051630-213051652 GACACCCAAGTCCCGCCAGTAGG - Intronic
921974222 1:221183358-221183380 GGAACTCTTGTCCCTGCAGCTGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
924668479 1:246098322-246098344 GAAACTCATGTCATTCCCGCAGG - Intronic
924672255 1:246140889-246140911 GAAACGCATTTCCTTCCAGCTGG - Intronic
1063379009 10:5572597-5572619 GTCACTCCTGCCCCTCCAGGAGG + Intergenic
1067878257 10:50023059-50023081 TACCCTCATGTCCCACCAGAGGG + Intergenic
1067893461 10:50154845-50154867 TACCCTCATGTCCCACCAGAGGG - Intergenic
1075842587 10:125517637-125517659 GACACCCACGTCACTCCAGTGGG - Intergenic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1076826597 10:132972584-132972606 GACACTCACGTTCCTCCCACGGG + Intergenic
1076893868 10:133299310-133299332 GAGAGACATGTCCTTCCAGCAGG + Intronic
1076990572 11:271345-271367 CCCACTCATGCCCCTCCACCAGG + Intergenic
1078498108 11:11841376-11841398 GCCCCTGAGGTCCCTCCAGCTGG + Intergenic
1078616551 11:12871215-12871237 GACACTGCTGTCGCTGCAGCTGG - Intronic
1081891212 11:46543698-46543720 GTCACTCATGTGCCTCTGGCTGG - Intronic
1084614561 11:70226938-70226960 GACACCCAGGTCCCTCTACCAGG + Intergenic
1087203963 11:95374608-95374630 GACCTTCCAGTCCCTCCAGCTGG - Intergenic
1088276860 11:108096594-108096616 GACACTCTTGTCGCTCAGGCTGG + Intronic
1090233017 11:125123348-125123370 GACACTCATTTCCCTGAACCTGG - Intergenic
1090241356 11:125184300-125184322 GACACTCATTCCCCTTCAGCAGG + Intronic
1092933915 12:13342443-13342465 GACTCACATGTCCCCCCAGATGG + Intergenic
1096518886 12:52173160-52173182 GACCTCCATGTACCTCCAGCTGG - Exonic
1102688636 12:114743373-114743395 TACACTCATGTCCCTACCGCTGG - Intergenic
1104465019 12:128983306-128983328 GTCACTCATGCACCTCCATCAGG - Exonic
1106419679 13:29575797-29575819 GGCACTCATGTCCCTCAAACAGG - Intronic
1111568659 13:90048875-90048897 GAGATTCAGGTTCCTCCAGCTGG + Intergenic
1113705820 13:112432570-112432592 GACACACCTGTCCCTTGAGCAGG - Intronic
1116946492 14:50840221-50840243 CATCCTCATGTCCCTACAGCAGG - Intergenic
1122388118 14:101362653-101362675 GCCCCTCAGGTTCCTCCAGCAGG + Intergenic
1126158534 15:45587430-45587452 GACACTCATGTCCCTCCAGCTGG - Exonic
1133036430 16:3036513-3036535 GACACTCACGTCCTGCGAGCAGG - Intronic
1134275418 16:12771676-12771698 GATACTCATTTTCCTCCAGCTGG - Intronic
1138553713 16:57760450-57760472 GACCCTGTTGCCCCTCCAGCTGG - Intronic
1141329208 16:83093357-83093379 GCCACTCACGGCACTCCAGCCGG - Intronic
1141850605 16:86642733-86642755 GCCAATAATGTGCCTCCAGCAGG - Intergenic
1147141977 17:38465206-38465228 CACACTCAGCCCCCTCCAGCTGG - Intronic
1152386003 17:79975136-79975158 GTCACTCCTCACCCTCCAGCAGG + Intronic
1153580011 18:6563243-6563265 GACACTCATTTCCCAGCTGCTGG + Intronic
1154165114 18:12008935-12008957 GCCGCCCATGTCCCTCTAGCAGG + Intronic
1157015741 18:43710818-43710840 CTCACTCTTGTCCCTCAAGCTGG + Intergenic
1158290929 18:55941514-55941536 GACATTCATTTCCCTCCCTCAGG - Intergenic
1158761396 18:60392078-60392100 GCCACTTATTTCCCTCCATCTGG - Intergenic
1159124352 18:64205962-64205984 GACACTCCAGTACCTCCAGAAGG - Intergenic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1160884945 19:1341441-1341463 GACACTCAGGGTCCTCCACCTGG + Intergenic
1161879985 19:6942428-6942450 GTTTCTCATGTCCCTCCAGCAGG - Intergenic
1163111850 19:15166088-15166110 CACACTCCTGTCCCTGCAGATGG - Exonic
1165315484 19:35052862-35052884 GAGAGTCATGGGCCTCCAGCTGG + Intronic
1166209378 19:41296393-41296415 GACCCACATGTCCCTTAAGCAGG - Intronic
1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG + Intergenic
925278840 2:2669169-2669191 GACACCCGTGTCCCACCACCGGG - Intergenic
927478245 2:23430536-23430558 GACTCTCTGGGCCCTCCAGCTGG + Intronic
929779370 2:44947943-44947965 AACACACATGTCCTTCCTGCAGG - Intergenic
930878386 2:56245231-56245253 GAAACTCAAGTTCCACCAGCTGG + Intronic
933650974 2:84850086-84850108 AACACTGATGTACCTCCAACGGG + Intronic
935358966 2:102231466-102231488 CTCACTCATGTCTCTCAAGCTGG - Intronic
935947608 2:108300481-108300503 GACCCCCATGTGCCTGCAGCAGG - Intronic
937449768 2:121992553-121992575 GCCACTCATGTCCTTAAAGCTGG - Intergenic
945807442 2:214507765-214507787 GACAGTCATGAGCCTCAAGCAGG + Intronic
946154982 2:217801349-217801371 GAGGGTCATGTCCCTTCAGCTGG - Exonic
947104153 2:226650610-226650632 GCCATGCATCTCCCTCCAGCTGG + Intergenic
948850756 2:240704248-240704270 GCCACTCAGGTGGCTCCAGCAGG + Intergenic
1170698717 20:18684098-18684120 GACCCTCATGTGGCTCCAGTAGG - Intronic
1172204965 20:33156839-33156861 GACACTCCTCTCCCCCAAGCAGG + Intergenic
1173573799 20:44096897-44096919 CACACTCAAGGCCCTCCATCTGG - Intergenic
1176250087 20:64116499-64116521 GACCCTCATCTCCCTTCAGGGGG - Intergenic
1178375881 21:32067251-32067273 GACAATTAAGTCCCTCCAGATGG + Intergenic
1178456442 21:32757822-32757844 GACAGTCATGTCCTTCCTACTGG - Intronic
1179891158 21:44335685-44335707 GAGCCTCACGTCCCTCCAGTGGG - Intronic
1179898709 21:44377814-44377836 GACAGTCATCTGCCTGCAGCAGG - Intronic
1180248398 21:46563490-46563512 GACAGACATGTGCCTCCTGCAGG + Intronic
1183154656 22:36065895-36065917 GTGACTGATGTCCCTCCGGCTGG + Intergenic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1184047372 22:41979792-41979814 TACTCTCATCTCCCTCCACCTGG - Intronic
1184991543 22:48173595-48173617 CACACCCCTCTCCCTCCAGCCGG - Intergenic
1185395620 22:50585970-50585992 GTCGCTGATGTCCCACCAGCAGG - Intronic
950263016 3:11555505-11555527 GAAACTCCTCTCCCTCAAGCAGG - Exonic
951955290 3:28246610-28246632 GATACCCATGTACCTCCAGATGG - Intronic
952138033 3:30445811-30445833 CACCCTCATGTCCCTCCACATGG - Intergenic
952817122 3:37455220-37455242 GACTGACATGTCCCTCAAGCAGG - Intronic
954542523 3:51403568-51403590 GGCACACATGTCCCTCAAGACGG + Intronic
958935816 3:100254345-100254367 GGCACTCATGTAACTCCAGTGGG - Intergenic
962195764 3:133362108-133362130 GACCCTCATCTCCCCACAGCAGG - Intronic
971159647 4:24120771-24120793 GACACTCATGGCCTTCCTGCTGG - Intergenic
972609073 4:40640552-40640574 CTCTCCCATGTCCCTCCAGCAGG - Intergenic
974057018 4:56993479-56993501 GACACTCAAGTCTCCCAAGCTGG - Intronic
977030023 4:91871657-91871679 TATACTCATGTCCTTTCAGCAGG + Intergenic
978802523 4:112769166-112769188 GTTTGTCATGTCCCTCCAGCAGG + Intergenic
979605773 4:122637365-122637387 GGCTCTCACATCCCTCCAGCAGG + Intergenic
986717361 5:10533772-10533794 GACACTCCTCTCCCTGCTGCAGG - Intergenic
990875331 5:60477805-60477827 GTCTCTCATATCCCTCCAACAGG - Intronic
1001945607 5:175775135-175775157 GTCACTCAGGTCCCTCTGGCTGG - Intergenic
1005114641 6:22322205-22322227 GACTTTCTTGTTCCTCCAGCTGG - Intergenic
1006356528 6:33562070-33562092 GTCATTCATGTCCCTTCAGCAGG - Intergenic
1006837367 6:37007082-37007104 GCCACCCATGTCCCTCCTTCAGG - Intronic
1008975674 6:57423498-57423520 TGCACTCATGTCACTCCAACTGG - Intronic
1012493505 6:99809164-99809186 TACACACATTTCCCTCAAGCTGG - Intergenic
1012661168 6:101894917-101894939 TACACACATATCCCTCCAACAGG + Intronic
1013686367 6:112589297-112589319 TCCACTCATGTCCCTACATCAGG - Intergenic
1019017400 6:168890021-168890043 GAAACTCATCTCACTCCACCAGG - Intergenic
1024509573 7:50192739-50192761 GACCCTCACATCCCTCTAGCTGG - Intergenic
1026845478 7:73696790-73696812 GCCTCTCATGTGCCTCCTGCAGG + Intronic
1030811649 7:113979854-113979876 GCCACTGATGCCCCTTCAGCTGG + Intronic
1033477785 7:141707231-141707253 TACACTCATGCCCCTCAAGGAGG - Intergenic
1035078117 7:156194319-156194341 GACACTCATCTCCAGCCTGCGGG - Intergenic
1038067641 8:23979759-23979781 GACACTCATATAACTGCAGCTGG - Intergenic
1039409464 8:37340558-37340580 GACACACATCTCCCACCTGCTGG - Intergenic
1040548933 8:48423580-48423602 GAGGCTGATTTCCCTCCAGCTGG + Intergenic
1044494800 8:92864048-92864070 GACACTTATAATCCTCCAGCAGG - Intergenic
1045322661 8:101093581-101093603 GACCCTCATGTCACACTAGCAGG - Intergenic
1047248654 8:123165637-123165659 CACCCTGACGTCCCTCCAGCTGG - Intergenic
1048918517 8:139206702-139206724 GAGGCCCATGTCCATCCAGCAGG + Intergenic
1055686812 9:78783942-78783964 CACACTCATGATCCACCAGCAGG + Intergenic
1188462647 X:30446370-30446392 GACTCTCATATCCTTCCAGCAGG - Intergenic
1189373142 X:40445680-40445702 CACACTCCTGTCCCTGCAGTAGG - Intergenic
1198276323 X:135098345-135098367 GACACTGTCGCCCCTCCAGCCGG + Intergenic
1200899281 Y:8411811-8411833 TTCACTCTTGTCCCTCAAGCTGG + Intergenic