ID: 1126158715

View in Genome Browser
Species Human (GRCh38)
Location 15:45588615-45588637
Sequence GACAGTGATGTGACAGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126158715 Original CRISPR GACAGTGATGTGACAGCAGC GGG (reversed) Intronic
900552852 1:3265182-3265204 GACAGGGATGAGACAGGAGCAGG + Intronic
900679347 1:3907751-3907773 GACAGGGAAGTCACAGCCGCAGG - Intergenic
900741957 1:4335869-4335891 GAGAATGGTGTGACAGGAGCTGG - Intergenic
901340539 1:8494889-8494911 GCCAGTGATGTGGCACCTGCAGG - Intronic
902606746 1:17573360-17573382 GCCAGAGAGGGGACAGCAGCTGG - Intronic
902744771 1:18466450-18466472 GTCAGTGATGTGGCTGGAGCAGG - Intergenic
906538070 1:46562925-46562947 GACTGTGATGGGACTGGAGCAGG + Intronic
906749785 1:48248512-48248534 ATCAGTGCTGTGACAGAAGCAGG - Exonic
907301335 1:53488382-53488404 GAGAGTGATGTGAGAGGTGCTGG - Intergenic
907312334 1:53546063-53546085 GACAGTGGTGTGCCTGCATCAGG + Intronic
911109679 1:94169394-94169416 GGGTGTGATGAGACAGCAGCTGG + Intronic
911440555 1:97920987-97921009 GAGAGCCAAGTGACAGCAGCCGG + Exonic
916428845 1:164708328-164708350 GACTGTTATGTGTCAGGAGCTGG + Intronic
920256532 1:204659045-204659067 GCCAGTGCTGTGAGACCAGCAGG + Intronic
920633490 1:207676399-207676421 GCCAGTGATCTGACAGGAGGTGG - Intronic
921595508 1:217049860-217049882 GAAAGTGAAGTGAAAGCAGCTGG + Intronic
922175051 1:223190243-223190265 GACAGAGATGGGACAACATCTGG - Intergenic
922202931 1:223421747-223421769 GGCAGGGTTGAGACAGCAGCAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1064676115 10:17762016-17762038 GGCAGTAATGTGACAGCTCCTGG - Intronic
1064781254 10:18841289-18841311 GCCACTGATGTGACAGGAGGTGG + Intergenic
1065256179 10:23870840-23870862 GACAGTTATGTAAAAGCAGCTGG - Intronic
1067324965 10:45258909-45258931 GACAATGAGGTGAGAGGAGCAGG - Intergenic
1070976511 10:80609772-80609794 GGCTGTGAGGTGACAGCAGTGGG - Intronic
1072254630 10:93609540-93609562 GAAACTGATGTGGCAGCAGAGGG + Intergenic
1075744443 10:124716883-124716905 GACAATGAGGGGACCGCAGCGGG + Intronic
1075997612 10:126891313-126891335 GACAGGGTTTTGAGAGCAGCCGG - Intergenic
1076617441 10:131765272-131765294 GCCTGTGATGGGACAGCAGCTGG + Intergenic
1077477521 11:2797431-2797453 GACCTTGATGACACAGCAGCTGG - Intronic
1077926318 11:6684783-6684805 GAAAGCGATGTGTTAGCAGCAGG - Intergenic
1080719153 11:34832423-34832445 GACATCTAAGTGACAGCAGCAGG - Intergenic
1082618265 11:55389238-55389260 CACAGTGATGTGGGAGCTGCAGG - Intergenic
1083639658 11:64138677-64138699 GACAGGGAGGAGGCAGCAGCGGG + Intronic
1084474764 11:69382477-69382499 GAGAGTCATGTGACTGGAGCTGG - Intergenic
1084568476 11:69944882-69944904 GACAGAAATGTGAAAGCAGGTGG - Intergenic
1086259524 11:84922479-84922501 GTCAGTGGGGTGACAACAGCGGG + Intronic
1086913256 11:92497174-92497196 GACAGAAATGTGACACTAGCTGG - Intronic
1087778318 11:102277135-102277157 GACAGTGCTGTGGAAGCAGTGGG - Intergenic
1088534015 11:110840227-110840249 CACAGTGATTTGGCAGCAGTGGG + Intergenic
1090077707 11:123589984-123590006 GACAGGGATGAGACAGCAGTGGG - Intronic
1091186249 11:133650282-133650304 GGCAGTGATTTGAGAGCAGGAGG - Intergenic
1092312168 12:7369534-7369556 GGAAGTGGTGTGTCAGCAGCTGG - Exonic
1094326740 12:29248633-29248655 GACAGGGTTTTGACAGCAACTGG + Intronic
1095384526 12:41634999-41635021 TACAGTCATTTGACAGCAGCAGG + Intergenic
1097021982 12:56027098-56027120 GGCAGTGCTGGGACAACAGCAGG + Intronic
1097593457 12:61599829-61599851 GACACACATGTGGCAGCAGCAGG - Intergenic
1098290156 12:68950644-68950666 GACAGGCATGAGGCAGCAGCTGG + Intronic
1099682260 12:85844077-85844099 GACTGGGCTGTGACAGCACCGGG - Intergenic
1100698264 12:97119029-97119051 GACGGAGATGAAACAGCAGCTGG - Intergenic
1102768859 12:115455738-115455760 GACTGGGCTGTGACAGCAGGAGG - Intergenic
1103841799 12:123871090-123871112 GACAGTGAAGCCACAGCATCGGG - Intronic
1103963630 12:124624588-124624610 GCCAGTGATGTTCCAGCAGGTGG - Intergenic
1105891700 13:24686851-24686873 GCTAGTCATGTCACAGCAGCAGG + Intronic
1107307942 13:39043052-39043074 AAAAGTGATGTTACAACAGCAGG + Intronic
1107351761 13:39522093-39522115 GAAAGTGATGTGACAAAAGTTGG - Intronic
1107572811 13:41681112-41681134 GAGAGTGATCTGACATCACCTGG - Intronic
1113300342 13:109012369-109012391 GCCACTGATTTGACAGGAGCTGG - Intronic
1113313685 13:109156980-109157002 GACTTTGAAGTGACAGCCGCAGG - Intronic
1113604944 13:111598429-111598451 GGCTGTGATGGGTCAGCAGCAGG + Intronic
1114435462 14:22702854-22702876 GACAATGATGTGGGAGGAGCAGG - Intergenic
1115444322 14:33471897-33471919 GCCACTGATCTGACAGGAGCTGG - Intronic
1116184016 14:41573212-41573234 GATACTGCTTTGACAGCAGCGGG - Intergenic
1117851498 14:59975993-59976015 GCCACTGATGTGACAGGAGGCGG - Intronic
1119201150 14:72753872-72753894 TACAGTGAGCTGCCAGCAGCTGG - Intronic
1121307037 14:92912951-92912973 ATCAGGGATATGACAGCAGCAGG + Intergenic
1121760653 14:96441964-96441986 AGCAGTGATGTGACACCAGCAGG - Intronic
1123661951 15:22572282-22572304 GTCAGTGCTATGAGAGCAGCTGG + Intergenic
1124262266 15:28203263-28203285 GTCAGTGCTATGAGAGCAGCTGG - Intronic
1124315748 15:28666525-28666547 GTCAGTGCTATGAGAGCAGCTGG + Intergenic
1124851530 15:33343513-33343535 GACAGTAAAGTGAGAGCATCTGG - Intronic
1126158715 15:45588615-45588637 GACAGTGATGTGACAGCAGCGGG - Intronic
1128509487 15:68304583-68304605 GACAGAAATGTGAGAGCAGTCGG - Intronic
1129276175 15:74447154-74447176 GACAGTGAGGGAACAGAAGCAGG - Intronic
1129623025 15:77166824-77166846 GACACTAATGTGACAAAAGCAGG + Intronic
1130049997 15:80476205-80476227 GACAGTCATGTGAAATCAGACGG + Intronic
1132317058 15:100897926-100897948 GACAGTGAAGGGACGGCATCGGG + Intronic
1132326623 15:100975295-100975317 TTCAGGGATGTGGCAGCAGCAGG + Intronic
1132723570 16:1328675-1328697 GACAGTGGTGAGTCAGGAGCAGG - Intergenic
1133344962 16:5063591-5063613 GCCACTGATCTGACAGCAGGCGG - Intronic
1135334541 16:21589838-21589860 GTTTGAGATGTGACAGCAGCAGG - Intergenic
1136133535 16:28240093-28240115 AACTGTGATGTGACAGCCACGGG - Intergenic
1136901866 16:34049138-34049160 GACAGTGAATTGACCCCAGCTGG + Intergenic
1137404139 16:48176677-48176699 GACGGAAATGTGACAGCTGCAGG - Intronic
1137718858 16:50615614-50615636 GACTGAGAGGTGGCAGCAGCCGG + Intronic
1137766869 16:50984572-50984594 GCCAGTGAGGTGACAACAGTGGG + Intergenic
1138882608 16:61033658-61033680 AACAGTGTTGTGAGAGCAGCTGG + Intergenic
1139312227 16:66037296-66037318 GACAGTTATGTGTCTGCTGCTGG - Intergenic
1139341535 16:66270807-66270829 GGCGGTGGGGTGACAGCAGCGGG - Intergenic
1139959815 16:70711049-70711071 GACACTGATGGGACAGGGGCTGG - Intronic
1144825664 17:18104364-18104386 GTCAGTGCTGTCACAGCAGATGG + Intronic
1147184106 17:38704546-38704568 GTCAGTGGTGTGACTGAAGCTGG + Intergenic
1147310832 17:39595386-39595408 GACAGTGATGAGACAGGAGCTGG - Intergenic
1147861563 17:43527091-43527113 GACTGAGATGTGACAACAGGTGG - Intronic
1148458024 17:47821328-47821350 GACAGGGATGTGGCAGGAACGGG + Intronic
1148460665 17:47837531-47837553 GACAGGGAGGGGACAGGAGCTGG - Exonic
1148531557 17:48398229-48398251 GCCACTGATCTGACAGGAGCTGG - Intronic
1151923829 17:77178750-77178772 GCCACTGATGTGACAGGAGGTGG + Intronic
1152562017 17:81083348-81083370 GAGAGTGACCTGCCAGCAGCAGG + Intronic
1152780857 17:82226923-82226945 CACAGTGATGTGATGGCTGCTGG - Intergenic
1153205592 18:2696361-2696383 GCCAGTGATCTGACAGGAGGCGG - Intronic
1154077942 18:11223731-11223753 GGCAGTGATGTCAGAGAAGCTGG + Intergenic
1154175884 18:12087106-12087128 GCCAGGGATATGGCAGCAGCAGG - Intergenic
1154939112 18:21093279-21093301 GCAAATGATGTGACTGCAGCTGG - Intronic
1156499518 18:37548722-37548744 TGCAGTGATGTGAGAGCAGAAGG + Intronic
1156577405 18:38334101-38334123 ACCAGTGATCTGACAGCAGTTGG - Intergenic
1157110549 18:44816386-44816408 GACAGAGAGGGGTCAGCAGCTGG + Intronic
1159021794 18:63149342-63149364 GCCACTGATCTGACAGGAGCCGG + Intronic
1160079946 18:75716456-75716478 GACAGAACTGTGACACCAGCAGG - Intergenic
1160780694 19:876796-876818 GTCAGTAAAGTGCCAGCAGCAGG - Intronic
1160973676 19:1781704-1781726 AGCAGTGATGTCACAGAAGCAGG - Intergenic
1161736684 19:5995877-5995899 GGCAGCGAGGGGACAGCAGCTGG + Intronic
1162831315 19:13286474-13286496 CCCAGTGATGTGAGAGCAGAGGG + Intronic
1163737068 19:18988111-18988133 GCCAGAGATGTGCCAGCAACAGG - Intergenic
1164402143 19:27909863-27909885 GACAGCGCTGGGGCAGCAGCGGG - Intergenic
1167368322 19:49065971-49065993 GACAGGGATGGGACCGGAGCCGG + Intergenic
1167936332 19:52911661-52911683 GACAGTGAAATGACAGAAACAGG + Intergenic
1168115155 19:54218205-54218227 GAGAGTGAGGTCACAGCAGGCGG + Intronic
1168124431 19:54275794-54275816 GAGAGTGAGGTCACAGCAGGCGG + Intronic
1168179664 19:54652532-54652554 AACAGAGAAGTGACAGCAGCTGG - Intronic
1168714077 19:58517075-58517097 GACAGTGAGGGGTCAGCATCAGG + Exonic
924983432 2:245160-245182 TGCAGTGATGTCACAGCAGTCGG - Intronic
925757343 2:7146589-7146611 CACATTGATCTCACAGCAGCTGG - Intergenic
926531529 2:14052393-14052415 GACGGTGACATGACAGCAGGCGG + Intergenic
928913844 2:36450321-36450343 GAAAGTGATGTGGCAACAGAAGG - Intronic
929053232 2:37855524-37855546 GCCAGGGAAGTGAAAGCAGCTGG + Intergenic
936245260 2:110820830-110820852 GGCAGTGAAGTGACAGCTTCAGG + Intronic
937151892 2:119691850-119691872 GACATTGCTGTGGCAGCAGCTGG + Intergenic
937191865 2:120109951-120109973 GACAGTGATTTTCCAGCAGATGG + Intronic
937789746 2:125945657-125945679 TGCAATGATGTGACATCAGCTGG + Intergenic
942520093 2:176794683-176794705 CACAGTGATGTGATAGGGGCTGG - Intergenic
942606153 2:177693252-177693274 AACAGGGATGAGACAGCTGCAGG + Intronic
945027431 2:205632434-205632456 GACACTGATCTGACAGGAGGCGG - Intergenic
947179015 2:227395638-227395660 CACAGTGATGTCACAGAAGCAGG - Intergenic
947773316 2:232687996-232688018 GGCAGTGATGTGCCAGCATCTGG - Intergenic
948264485 2:236627041-236627063 GGCACTTATGTGGCAGCAGCAGG - Intergenic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
948630192 2:239297438-239297460 GACACTGGTGTGACAGCATAGGG + Intronic
948768491 2:240235440-240235462 GCCGGTGGGGTGACAGCAGCAGG - Intergenic
949060922 2:241956840-241956862 GACAGTGACTTGAAGGCAGCTGG + Intergenic
1169491757 20:6077007-6077029 GAAAGGGATGTGCCAGCAGTGGG + Exonic
1170059558 20:12245011-12245033 GAAAGTGATGGGGCAGCTGCTGG - Intergenic
1170807712 20:19647445-19647467 GGCATTGATGTGCCAGCACCCGG - Intronic
1173077626 20:39834776-39834798 GACAGGGATGACACAACAGCAGG - Intergenic
1173738457 20:45378358-45378380 TTCAGTGATGTCACAGCTGCAGG - Exonic
1174110045 20:48192704-48192726 AACAGTGATGTGACATCATTAGG + Intergenic
1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG + Intronic
1176296848 21:5077840-5077862 GACAGGGATGGAACAGGAGCTGG + Intergenic
1176296959 21:5078787-5078809 GACAGGGATGGAACAGGAGCTGG + Intergenic
1176512494 21:7759248-7759270 GGGAGTGAGGTGGCAGCAGCTGG + Intronic
1177420700 21:20853095-20853117 GAATGTGATGTGACAGTAGAAGG - Intergenic
1177544901 21:22544074-22544096 GAAAGTGTTGTGACATTAGCTGG - Intergenic
1178096683 21:29222886-29222908 AACAGTGGTGCGACAGCCGCGGG + Intronic
1178456807 21:32762413-32762435 CACAGTGATGTTTCAGCTGCTGG + Intronic
1178646607 21:34389773-34389795 GGGAGTGAGGTGGCAGCAGCTGG + Intronic
1179097496 21:38328718-38328740 GCCACTGATTTGACAGCAGGTGG + Intergenic
1179860069 21:44183160-44183182 GACAGGGATGGAACAGGAGCTGG - Intergenic
1179860180 21:44184107-44184129 GACAGGGATGGAACAGGAGCTGG - Intergenic
1179860201 21:44184281-44184303 GACAGGGATGGAACAGGAGCTGG - Intergenic
1179898709 21:44377814-44377836 GACAGTCATCTGCCTGCAGCAGG - Intronic
1180059800 21:45378993-45379015 GACAGTGATGAGAAAGAATCAGG - Intergenic
1180161222 21:45999488-45999510 GACGGTGCTGTGAGGGCAGCTGG - Intronic
1180835421 22:18927183-18927205 GACAGAGATGTGACAGAAGAGGG + Intronic
1181496876 22:23292176-23292198 CACAGTGATGCCACAGCAGAGGG - Intronic
1182423792 22:30261337-30261359 CAGGGTGATGTAACAGCAGCGGG - Intergenic
1184183785 22:42849856-42849878 GAAAGTAAGGTGACAGGAGCCGG - Intronic
1185380498 22:50505549-50505571 GACAGTCATGGGTCAGCAGAGGG + Intronic
1203285509 22_KI270734v1_random:152482-152504 GACAGAGATGTGACAGAAGAGGG + Intergenic
951553603 3:23898874-23898896 GCCACTGATGTGACAGGAGGCGG - Intronic
956345354 3:68271895-68271917 AGCAGGGATGTGACACCAGCTGG + Intronic
957664227 3:83203200-83203222 GACACTGATGGGAGAGCAACTGG - Intergenic
957726882 3:84077671-84077693 GGCAGTGATGTGGTAGCTGCTGG + Intergenic
958118921 3:89259300-89259322 GACTGTGATGTGATAGGAGGTGG - Intronic
961867975 3:129967883-129967905 GATAGTTCTGTGTCAGCAGCTGG + Intergenic
962948975 3:140200553-140200575 GCCAGGGATGTGAAAGCATCAGG + Intronic
965077746 3:164001618-164001640 GAGAGTTATTTGACAGCAGCGGG - Intergenic
965398402 3:168188750-168188772 GACAGTGATGGAACAGGAGCGGG - Intergenic
966584903 3:181611926-181611948 GACAGTGATGGGCCAGGAGGGGG - Intergenic
968045147 3:195619785-195619807 GAAAGAGAAGTGACAGCACCCGG + Intergenic
968061002 3:195726122-195726144 GAAAGAGAAGTGACAGCACCCGG + Exonic
968714022 4:2141331-2141353 GACAGAGAGGGGAGAGCAGCTGG - Intronic
970587624 4:17529584-17529606 GACAGTTATGTGATAGGAGACGG + Intergenic
973223057 4:47750952-47750974 CACAGTGATGTGTGAGCAGACGG + Intronic
973809778 4:54558299-54558321 GAGAGAGATGTCCCAGCAGCTGG - Intergenic
974611104 4:64217369-64217391 GAAACAGATGTGACAGCAGATGG - Intergenic
975708446 4:77134662-77134684 GATAGTGATGTGAAAGCACCTGG + Intergenic
977175539 4:93815515-93815537 GACAGTAAAGTGACACCACCTGG - Intergenic
977386892 4:96352060-96352082 CACTGTGATGTGTGAGCAGCAGG - Intergenic
978415319 4:108468825-108468847 GTCATAGATGTCACAGCAGCGGG - Intergenic
979294909 4:119021088-119021110 GATATTGATGTGTCAGCAGTGGG + Intronic
979623421 4:122821006-122821028 CCGAGTGATGTGACAGCAGAAGG - Intergenic
982400265 4:154959034-154959056 GGCATTGCTGTGACAGCAACAGG - Intergenic
983123166 4:163913962-163913984 GAAAGGGATGTGACAGCACGGGG + Intronic
985641411 5:1065058-1065080 GACAGTGAGGGGACAGCAAGGGG + Intronic
985975181 5:3414262-3414284 GACAGTGTTGTGGGAGCAGAAGG - Intergenic
986130691 5:4927147-4927169 CTCTGTGATGTCACAGCAGCTGG + Intergenic
988372062 5:30383335-30383357 GTCAGTAATATGACAGCACCTGG + Intergenic
991049795 5:62260630-62260652 GCCAGTGATCCGACAGCTGCTGG - Intergenic
991244055 5:64490061-64490083 AGCAGTGTTGTGACACCAGCAGG - Intergenic
995500559 5:112800991-112801013 GATAGTAATGTGAGCGCAGCTGG + Intronic
996318806 5:122191088-122191110 GACTGAGATGAGACAGCAGGTGG + Intergenic
997508423 5:134436584-134436606 GACAGTGACGTGCAGGCAGCTGG + Intergenic
997998257 5:138603765-138603787 GAGAGTGTTGTGACACGAGCAGG + Intergenic
997998847 5:138608116-138608138 GACAGTGATTTGACATAAACTGG - Intergenic
998496262 5:142592555-142592577 GAGAGTCACGTGACAGGAGCTGG + Exonic
999113528 5:149141931-149141953 GACAGAGAGGGGACAGCAGAGGG + Exonic
1000993874 5:167939338-167939360 GCCACTGATGTGACAGGAGGCGG + Intronic
1003275062 6:4643370-4643392 GACAGTGGTGGGAGAACAGCAGG + Intergenic
1006573518 6:35025531-35025553 GGAAGTGAAGTGGCAGCAGCAGG - Intronic
1011221912 6:85063737-85063759 GACAGTGATATGCCAGCATTTGG - Intergenic
1011570634 6:88730596-88730618 GCCACTGATCTGACAGCAGGCGG + Intronic
1012754486 6:103207972-103207994 GGCAGTGTTGTGACAGAAGCTGG + Intergenic
1013014140 6:106145802-106145824 GGCAGTGCTTTGACAGCAGGTGG + Intergenic
1013036323 6:106387484-106387506 GACAGGGAGGTGACAGCAGGAGG - Intergenic
1013636515 6:112034077-112034099 GACAGTGAAATTACAGGAGCTGG - Intergenic
1018412463 6:163565360-163565382 GAAAGTGCTGGAACAGCAGCTGG - Intronic
1018870883 6:167781239-167781261 CACAGTGATGTGCCATCAGGTGG + Intergenic
1019087893 6:169499351-169499373 GACAGTGTGATGACAGCATCTGG + Intronic
1019688141 7:2393868-2393890 GAGAGTTCTTTGACAGCAGCGGG - Intergenic
1019816809 7:3207069-3207091 CACAGTGACGTGTCAGCAGGTGG + Intergenic
1020226498 7:6284564-6284586 GAGAGTGGTGTGACTGCAGCAGG + Intergenic
1021687707 7:23203236-23203258 AACAATGAGGTGGCAGCAGCTGG + Intergenic
1022999759 7:35796589-35796611 GAGAGTGAAGTGGGAGCAGCAGG + Intergenic
1023855776 7:44182860-44182882 GCCAGTGAGGTGCCAACAGCAGG - Intronic
1024586432 7:50845800-50845822 GACAGTGTTTTGAGAGCAACTGG - Intergenic
1024804575 7:53122568-53122590 GACAGTGAATTAACACCAGCTGG - Intergenic
1025068193 7:55875367-55875389 TGCAGTGATGTAACACCAGCTGG - Intergenic
1025108118 7:56190132-56190154 GCCACTGATGTGACAGGAGGTGG + Intergenic
1029100375 7:98124921-98124943 GACAGTGATTTGATACCAGGAGG - Intronic
1030243735 7:107359272-107359294 GGCTGAGATGTGACAGCACCTGG - Intronic
1031263819 7:119557403-119557425 AACAGTTATATGACAGAAGCTGG + Intergenic
1031497236 7:122465494-122465516 GACACTGATCTGACAGGAGGTGG - Intronic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1031758406 7:125677437-125677459 GACAGTGAAATGACATCTGCAGG - Intergenic
1031975425 7:128090539-128090561 GAAAGTGATGAGAGGGCAGCAGG + Intronic
1037700313 8:21267810-21267832 GTGAGTGATGAGACAGAAGCAGG + Intergenic
1038362404 8:26894078-26894100 GCCAGTGATCTGACAGGAGGTGG - Intergenic
1040578552 8:48675846-48675868 TACAGGGATGTAACAACAGCGGG - Intergenic
1040946815 8:52893255-52893277 GGCAGTGATGTCACAGCCACAGG - Intergenic
1041359429 8:57036459-57036481 GAGAGTCTTGTGACTGCAGCTGG + Intergenic
1041394403 8:57376469-57376491 GACAGTGTTCTGACTGGAGCAGG - Intergenic
1041502734 8:58556323-58556345 GCCACTGATCTGACAGGAGCTGG + Intronic
1046508445 8:115166634-115166656 AACAGTGAAGTGGCAGCAGGGGG + Intergenic
1046586656 8:116156223-116156245 CAGAGTGTTGTCACAGCAGCAGG - Intergenic
1047996140 8:130338266-130338288 CACAGTTAAGTGGCAGCAGCAGG + Intronic
1050213568 9:3293221-3293243 GACAATTATGAGACAGCAGAAGG - Exonic
1050410384 9:5357940-5357962 GACAGAGAAATGAGAGCAGCTGG + Intergenic
1051088566 9:13380202-13380224 GAAAGAGATGTGAAGGCAGCAGG - Intergenic
1052654305 9:31335384-31335406 GACTGGGCTGTGACAGCACCTGG + Intergenic
1054747466 9:68869244-68869266 GCCAGTGATCTGACAGGAGGCGG - Intronic
1056114824 9:83431897-83431919 CAGAGTGCTGTGCCAGCAGCTGG - Intronic
1059406398 9:114100300-114100322 AACAGGGATGTGACACCATCAGG + Intergenic
1060279779 9:122208080-122208102 TACAGTGATGTTTCTGCAGCAGG + Intronic
1061697783 9:132390447-132390469 GAGAGTGATATGGAAGCAGCTGG + Intronic
1061973832 9:134058501-134058523 GACAGGGATGTAACAGGGGCTGG - Intronic
1062644488 9:137540514-137540536 CACAGTGATGTGAGGGGAGCAGG - Intronic
1188444922 X:30246355-30246377 GACCTTGATGTGAGAGGAGCAGG + Exonic
1188464197 X:30460418-30460440 GATAGAGATGTGGCAGGAGCTGG - Intergenic
1190379038 X:49820141-49820163 ACCAGTGATGTGACAGGAGGTGG - Intergenic
1191152472 X:57234690-57234712 GCCAGTGATCTGACAGGAGGCGG + Intergenic
1192494948 X:71609964-71609986 GACAGTGGTGTCACATCAGATGG + Intronic
1194347780 X:92786992-92787014 GATAGTGATGTGAGGGAAGCAGG - Intergenic
1198579673 X:138049445-138049467 GGCGGGGATGGGACAGCAGCAGG - Intergenic
1198928996 X:141832435-141832457 GACAGTGACGTCATAGCAGAGGG + Intergenic
1199017279 X:142833220-142833242 GAAAGAGATGTGAGAGAAGCAGG - Intergenic
1200656105 Y:5903628-5903650 GATAGTGATGTGAGGGAAGCAGG - Intergenic