ID: 1126163495

View in Genome Browser
Species Human (GRCh38)
Location 15:45634860-45634882
Sequence CGCTCACGGGGCACAGAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 70}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163495_1126163507 28 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297
1126163495_1126163508 29 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163508 15:45634912-45634934 GGTGCCTGGGCTGCGGCGCCGGG 0: 1
1: 0
2: 5
3: 28
4: 349
1126163495_1126163505 22 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163495_1126163504 16 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1126163495_1126163502 8 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163495_1126163498 -10 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163498 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1126163495_1126163503 15 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163495 Original CRISPR CGCTCACGGGGCACAGAACC AGG (reversed) Exonic
901634589 1:10664697-10664719 AGCTTACCGGGCACAGTACCTGG - Intronic
904812227 1:33170897-33170919 GCCTCACAGGGCACAGAGCCTGG + Intronic
905033992 1:34905228-34905250 AGCTCTCGGGGCACAGAAGCGGG + Exonic
905296441 1:36957358-36957380 GGCTCACAGGGCACAGACTCAGG - Intronic
905296469 1:36957534-36957556 GGCTCACGGGGCACAGGACACGG - Intronic
905296787 1:36959472-36959494 GGCTCACAGGGCACAGAGTCAGG - Intronic
917963715 1:180165726-180165748 TGCTCACGGGGCACCTGACCTGG + Intronic
918311965 1:183291388-183291410 CGCTCCCAGGGCACAGGGCCTGG - Intronic
923612203 1:235505017-235505039 CGTTCCCAGAGCACAGAACCGGG - Intergenic
1063056535 10:2510625-2510647 GGCTGACAGTGCACAGAACCAGG + Intergenic
1063072385 10:2679841-2679863 GGCTCCCAGGGCACAGAGCCAGG + Intergenic
1063173965 10:3535182-3535204 CGCTCACGGCACAGAGCACCTGG - Intergenic
1065239655 10:23693650-23693672 CGCAGAAGGCGCACAGAACCAGG + Intergenic
1067243203 10:44513908-44513930 TGCTCACGGTGCAAAGATCCAGG + Intergenic
1075404740 10:122187260-122187282 CCCTCAAGGGGCACACAACCAGG - Intronic
1075629496 10:123992353-123992375 CCCTCTCGGGGGACAGAACCTGG + Intergenic
1076829720 10:132988425-132988447 CGCTCATGACGCACAGAATCCGG - Intergenic
1077180090 11:1208431-1208453 CCCTCACGGGACACAGGCCCAGG - Intergenic
1078020387 11:7651890-7651912 CCCTCACGCAGCACAGCACCTGG + Intronic
1079320786 11:19449705-19449727 CCCTCAAGGGGCACACAACCTGG - Intronic
1081994548 11:47355122-47355144 CGCTCCCGGGGCCCAGAGGCAGG - Exonic
1082975326 11:59064679-59064701 AGGTCACGGGCCACAGACCCTGG - Intergenic
1083837700 11:65282688-65282710 CGCTCACTGGGCTCAGACCAGGG - Intronic
1085278477 11:75314941-75314963 TGTTCACCGGGCACTGAACCAGG - Intronic
1086961368 11:92982501-92982523 TGCTCACAGGCCACAGGACCTGG + Exonic
1088586113 11:111361296-111361318 TGGCCCCGGGGCACAGAACCAGG - Intronic
1090626238 11:128611293-128611315 TGCTCAGGTGGCACAGAACATGG + Intergenic
1096241447 12:49962188-49962210 CGCTCACGGGTCCCAGGGCCTGG - Exonic
1099640708 12:85280218-85280240 AGCTCCTGGGGCACAGAAACTGG - Exonic
1103723098 12:122985091-122985113 GGCCCACGGGACCCAGAACCAGG + Exonic
1103933803 12:124464795-124464817 CGCTCCAGGGTCACAGAGCCAGG + Intronic
1104487531 12:129164187-129164209 CTCCTGCGGGGCACAGAACCTGG - Intronic
1113800247 13:113082720-113082742 CGCCCACGTGGCACCGTACCTGG + Intronic
1113914960 13:113864682-113864704 CACTCACGGGGGACCGAACCAGG + Intergenic
1114656240 14:24317202-24317224 AGGTCCCGGGTCACAGAACCTGG - Exonic
1115752574 14:36506416-36506438 CCTCCACGGGGTACAGAACCCGG + Intronic
1122838332 14:104442339-104442361 CCCTCACGAGGCACAGGAGCAGG + Intergenic
1124253293 15:28121712-28121734 CACACACAGGGCACAGAACAGGG + Intronic
1126163495 15:45634860-45634882 CGCTCACGGGGCACAGAACCAGG - Exonic
1128543225 15:68551214-68551236 CGCTCACAGGGCACGGAGCCAGG + Intergenic
1131830487 15:96351948-96351970 CTCTCACGGGGCACGGCACTGGG + Intergenic
1132937030 16:2486408-2486430 CAGTCACGGGCCACAGAACAGGG - Intronic
1134684980 16:16152290-16152312 GGCTCACTGGGCTCACAACCTGG - Intronic
1137026917 16:35486150-35486172 AGCTCACAGGGCCCAGCACCCGG - Intergenic
1142749057 17:1976726-1976748 AGCTCACGGGGCAGGGAGCCAGG + Intronic
1143010028 17:3861168-3861190 GGATCACGAGACACAGAACCTGG - Intronic
1143217345 17:5234894-5234916 AGCCCACGGGGCAGAGACCCTGG + Intergenic
1151326992 17:73385727-73385749 CGCTCTGGGGGCAGAGAACTTGG + Intronic
1158727426 18:59986325-59986347 CACTCCCTGGGCACAGAAGCTGG - Intergenic
1160429032 18:78798973-78798995 CCCCCACGGGGCTCAGAGCCAGG - Intergenic
1160693242 19:469901-469923 TTCTCACGGGGCACTGAGCCAGG - Intronic
1162728539 19:12703856-12703878 AGCTCAGGGGGCACAGTCCCTGG + Intronic
1167346036 19:48946349-48946371 CCCTCACCTGGCACAAAACCCGG - Intergenic
1167908904 19:52685248-52685270 CGCTCACTGGGCTCAGAGCGGGG + Intronic
927933277 2:27059382-27059404 CTCTGACGGGGCCCAGCACCCGG - Exonic
928126543 2:28620495-28620517 CGCCCCAGGGGCCCAGAACCCGG + Intronic
928520711 2:32085757-32085779 CGCTCACGAGCCACCGCACCTGG - Intronic
932320692 2:70820166-70820188 GGTGCACAGGGCACAGAACCTGG + Intronic
938157212 2:128951930-128951952 CACTCTCTGGCCACAGAACCTGG + Intergenic
947766298 2:232640024-232640046 CACTCAGGGGACACAGAAGCAGG - Intronic
1170575437 20:17659043-17659065 GGCTGAGGGGGCCCAGAACCAGG - Intronic
1170575539 20:17659373-17659395 GGCTGAGGGGGCTCAGAACCAGG - Intronic
1175152269 20:56944483-56944505 CGCTCACGGGGCATGCAGCCAGG - Intergenic
1179642447 21:42756556-42756578 CGCTCACGGGCCACAGCCCTGGG - Intronic
1179642461 21:42756603-42756625 CGCTCACGGGCCACAGCCCTGGG - Intronic
1180676154 22:17587780-17587802 CGCTCACGGGGCACAAAAGAAGG + Intronic
1182711686 22:32327299-32327321 CTATCACTGGGCACAGATCCAGG + Intergenic
956899906 3:73704529-73704551 GGCTCCAGGGGCACAGAACAGGG + Intergenic
962751111 3:138435263-138435285 CGCTCCCGGGGCGCAGACCCTGG + Intronic
968897728 4:3414428-3414450 CGCTCCCTGGGGGCAGAACCAGG - Intronic
985912903 5:2897138-2897160 GGCTCACGGGGCCCAGAGCCGGG - Intergenic
994811853 5:104529373-104529395 CGCTATCTGGGAACAGAACCAGG - Intergenic
999390078 5:151183288-151183310 GGCTCACTGGGCACACACCCAGG + Exonic
1003049313 6:2765670-2765692 GGCACACGGGGCACTGCACCTGG - Exonic
1007629055 6:43262754-43262776 CCCTCACGGGGCTCAATACCTGG - Intronic
1013071185 6:106730817-106730839 CAAGCCCGGGGCACAGAACCTGG + Intergenic
1036034421 8:5003739-5003761 CTTTCACAGGGCACAGAAGCAGG + Intergenic
1037737548 8:21579647-21579669 GGCTCCTGGGGCACAGAGCCCGG - Intergenic
1060989678 9:127841253-127841275 TTCTCACGGGGCACAGGGCCAGG - Intronic
1061001880 9:127907284-127907306 CTCTCACTGGGTACAGAACGGGG + Intergenic
1189322288 X:40094368-40094390 GGTTCACGGCGGACAGAACCCGG + Intronic